Sequences from confirmation amplicon


Confirmation sequences for line 006A03 and hit At3g02130 are shown.
Line ID 006A03
Locus At3g02130 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:382603
Primers used for PCR DL89 - 8474, show primer details
   
Sequence Name 59-K018753-022-006-A03C-DL89
GenBank Accession LN509859 [GenBank]
Sequencing primer gene specific primer, DL89: 5'-GTAAATGCAAGAACCTTCGTCTTC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K018753-022-006-A03C-DL89
ATTTGAGCTCGAATAGGCTTACTGGGGAGCTTCTCAAAGAGATTTCGGTCCCATGCATGA
GTGTTTTTGATGTTGGTGGAAACAGCTTATCGGGTGTAATCCCTGATTTTCTCAACAATA
CCACAAGCCATTGTCCTCCTGTTGTTTACTTTGACAGGTTTTCTATTGAATCTTACAGCG
ACCCGTCGTCTGTTTATCTCTCCTTCTTTACCGAGAAGGCTCAAGTTGGAACTTCCCTGA
TAGATCTTGGAAGTGATGGAGGTCCGGCCGTGTTTCATAATTTTGCAGACAACAACTTCA
CTGGTACTCTCAAGTCTATACCACTTGCACAGGAACGGTTGGGAAAGCGAGTCTCTTACA
TATTTTCTGCTGGAGGGAATCGGTTGTACGGGCAATTTCCGGGAAATCTGTTTGATAACT
GCGACGAACTCAAAGCTGTTTATGTCAATGTAAGCTTCAACAAGCTCTCAGGTCGGATTC
CTCAGGGACTAAACAACAAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAAT
   
Sequence Name 63-K018753-022-006-A03C-8409
GenBank Accession LN510878 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>63-K018753-022-006-A03C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTTGTTGTTTAGTCCCTGA
GGAATCCGACCTGAGAGCTTGTTGAAGCTTACATTGACATAAACAGCTTTGAGTTCGTCG
CAGTTATCAAACAGATTTCCCGGAAATTGCCCGTACAACCGATTCCCTCCAGCAGAAAAT
ATGTAAGAGACTCGCTTTCCCAACCGCTCCTGTGCAAGTGGTATAGACTTGAGAGTACCA
GTGAAGTTGTTGTCTGCAAAATTATGAAACACGGCCGGACCTCCATCACTTCCAAGATCT
ATCAGGGAAGTTCCAACTTGAGCCTTCTCGGTAAAGAAGGAGAGATAAACAGACGACGGG
TCGCTGTAAGATTCAATAGAAAACCTGTCAAAGTAAACAACAGGAGGACAATGGCTTGTG
GTATTGTTGAGAAAATCAGGGATTACACCCGATAAGCTGTTTCCACCAACATCAAAAACA
CTCATGCATGGGACCGAAATCTCTTTGAGAAGCTCCCCAGTAAGCCTATTCGAGCTCAAA
TCA
Primers used for PCR FM52 - 3144, show primer details
   
Sequence Name 13-K029297-022-006-A03C-3144
GenBank Accession LN491904 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K029297-022-006-A03C-3144
ATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA
CAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTCC
CCAACAAGTCTCGGGGATCTAGCTTCACTTGTTGCTCTTAATCTGAGCTGGAATCAGTTG
CAAGGTCAGATACCGGGTAGCCTCGGGAAGAAGATGGCAGCTTTGACATATCTTTCGATT
GCGAATAACAACCTCACGGGGCAAATTCCTCAGAGCTTTGGTCAGTTACATTCCTTGGAT
GTTCTTGATCTCTCTTCAAATCATCTATCTGGCGGTATTCCTCATGATTTCGTAAACTTG
AAGAATCTCACTGTCCTGCTTCTCAACAATAACAACCTCTCTGGCCCAATCCCGTCGGGT
TTTGCGACATTTGCTGTTTTCAATGTTTCCTCCCAACA
   
Sequence Name 14-K029297-022-006-A03C-FM52
GenBank Accession LN492375 [GenBank]
Sequencing primer gene specific primer, FM52: 5'-ATTGTTGGAGGAAACATTGAAAAC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K029297-022-006-A03C-FM52
TGGGCCAGAGAGGTTGTTATTGTTGAGAAGCAGGACAGTGAGATTCTTCAAGTTTACGAA
ATCATGAGGAATACCGCCAGATAGATGATTTGAAGAGAGATCAAGAACATCCAAGGAATG
TAACTGACCAAAGCTCTGAGGAATTTGCCCCGTGAGGTTGTTATTCGCAATCGAAAGATA
TGTCAAAGCTGCCATCTTCTTCCCGAGGCTACCCGGTATCTGACCTTGCAACTGATTCCA
GCTCAGATTAAGAGCAACAAGTGAAGCTAGATCCCCGAGACTTGTTGGGGAAACACTGAT
AGTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGGGTACCCTGTCCTCTCCAAAT
GAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCAT
CCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGT
CTTCTTTTTCCACGATGCTCCTCGTGGGTGG

Last Updated on 23.10.2014 13:25