Sequences from confirmation amplicon


Confirmation sequences for line 027F07 and hit At5g36290 are shown.
Line ID 027F07
Locus At5g36290 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:14304429
Primers used for PCR RK75 - 8474, show primer details
   
Sequence Name 23-K021056-022-027-F07C-8409
GenBank Accession LN496378 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K021056-022-027-F07C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGACTTCCCATCATCTTTGGT
AACATTCAAACTTGTCTGACTTCCCATCATCTTTGGTAAAGGTTGAAGAGAAGCTCGAGT
CAGGTCAAGGGAAGACACCCTTCCGTCGTTTATTCTCAAGATTTTGTACCCCAATATTTC
TGGAGGTATTTTTCTAGGGCATATTGATGCTTTCGGTTGTATGATTTTTGCGGTAAACTG
TTTAAAAAGTTGCTATAACCCCTTCTCTTGTATTTTTTTGCAGTCCTTCATCTTAACCTT
TCTAGCTGAATGGGGTGACCGTAGCCAGATCGCTACAATAGCTGTAAGAGTCATCTCTCA
TATCTAGCTTCTTACTAAAATTGACCAGTGACTGACTTTTATCTTTTTTTGAAGTTGGCG
ACTCACAAGAACGCCATAGGAGTGGCCATTGGGGCAAGTATTGGACACACTGTGTGTACT
TCACTAGCA
   
Sequence Name 24-K021056-022-027-F07C-RK75
GenBank Accession LN496820 [GenBank]
Sequencing primer gene specific primer, RK75: 5'-CCTCCAACAACTGCTAGTGAAGTA-3'
Sequence (A. th genome BLAST matches underlined)
>24-K021056-022-027-F07C-RK75
CACAGTGTGTCCAATACTTGCCCCAATGGCCACTCCTATGGCGTTCTTGTGAGTCGCCAA
CTTCAAAAAAAGATAAAAGTCAGTCACTGGTCAATTTTAGTAAGAAGCTAGATATGAGAG
ATGACTCTTACAGCTATTGTAGCGATCTGGCTACGGTCACCCCATTCAGCTAGAAAGGTT
AAGATGAAGGACTGCAAAAAAATACAAGAGAAGGGGTTATAGCAACTTTTTAAACAGTTT
ACCGCAAAAATCATACAACCGAAAGCATCAATATGCCCTAGAAAAATACCTCCAGAAATA
TTGGGGTACAAAATCTTGAGAATAAACGACGGAAGGGTGTCTTCCCTTGACCTGACTCGA
GCTTCTCTTCAACCTTTACCAAAGATGATGGGAAGTCAGACAAGTTTGAATGTTACCAAA
AATGATGGGAAGTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
T
Primers used for PCR RK74 - 8474, show primer details
   
Sequence Name 31-K021167-022-027-F07C-RK74
GenBank Accession LN499974 [GenBank]
Sequencing primer gene specific primer, RK74: 5'-TATTTGACATGGTGAAATGGTAGG-3'
Sequence (A. th genome BLAST matches underlined)
>31-K021167-022-027-F07C-RK74
AAATTGATTCATTTAGTAGAAAAGTAGCTATCCAAACTGATTTCTTCATGTCTTTTTTTG
TGAATATGTAAAACACTTAAATGTTAAGAGTAGATATCTGTATTATCATTGGAATTGGTG
CACTTACTTGTAAGTTTTGGTGGCTCTTTCTTTTTAATCTGAATCTCACTTGAAGGATCT
TACATCTTTGAAAATGCAGTGCTCTATGCATTTTTTGGTTTGCGACTACTCTACATTGCT
TGGAGGTCTACTGATTCAAAGTCAAATCAGAAGAAAGAAATGGAGGAAGTAAGTTGTTCT
CATGCTACCTGTGTTGCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTC
TAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16