Sequences from confirmation amplicon


Confirmation sequences for line 034F02 and hit At3g18580 are shown.
Line ID 034F02
Locus At3g18580 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:6397026
Primers used for PCR JG06 - 8474, show primer details
   
Sequence Name 13-K022409-022-034-F02C-8409
GenBank Accession LN491850 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K022409-022-034-F02C-8409
ATTTCCCGGACATGATCAATATTGATCAATATTACTCTGTATAGATCAATATTGCCTCCA
TGGAGAGAAAACAGAGATCAATATTTAATTGTTTCCCAATGAAATATGTAAGAAATGGAG
TTTTAGGGGTTGAGCCATTAGTACCGTTTCTACGAATTGCTACTTCTCTTATACGTCGAA
CCAAACCAGTGACAGGATCAGTGAATATCTTCGTCTCCAGATTACCCTCTAAGTAGATAA
CAGTACTGTTGAATGAACACGAAACAAGTTGTTATGACACATACACAAAAGCAAGCTACC
ATTTTGAATCTAGCAAGCAAGATTCACCTAAAGTTTCATCCTTTTTCACCGATTCTTGAT
CGATATCAGACATGATACATACATTTGTTCCTTATTCTATCATCACATAACCTTACAAGC
TAAATATGATCTCAGAAGAGAACTAACCCGGGTTCAACATTCTTCAACACAAGATCTGCC
AAGCGTTCAGGGTAAACAGAGACACGGTGCCACTGCACCGCAGACCGGCTCGCATACTCT
CTCGGATCTTCGTTAATAAGCGGTCTCCGGTTGTTCCTGATCCCACCAGTTCCTACAGAG
AAGAGAGTGACAGTTCTACCACTCTT
   
Sequence Name 14-K022409-022-034-F02C-JG06
GenBank Accession LN492319 [GenBank]
Sequencing primer gene specific primer, JG06: 5'-CTGCAGAAGAAGCTTAAGAGTGGT-3'
Sequence (A. th genome BLAST matches underlined)
>14-K022409-022-034-F02C-JG06
TGTCACTCTCTTCTCTGTAGGAACTGGTGGGATCAGGAACAACCGGAGACCGCTTATTAA
CGAAGATCCGAGAGAGTATGCGAGCCGGTCTGCGGTGCAGTGGCACCGTGTCTCTGTTTA
CCCTGAACGCTTGGCAGATCTTGTGTTGAAGAATGTTGAACCCGGGTTAGTTCTCTTCTG
AGATCATATTTAGCTTGTAAGGTTATGTGATGATAGAATAAGGAACAAATGTATGTATCA
TGTCTGATATCGATCAAGAATCGGTGAAAAAGGATGAAACTTTAGGTGAATCTTGCTTGC
TAGATTCAAAATGGTAGCTTGCTTTTGTGTATGTGTCATAACAACTTGTTTCGTGTTCAT
TCAACAGTACTGTTATCTACTTAGAGGGTAATCTGGAGACGAAGATATTCACTGATCCTG
TCACTGGTTTGGTTCGACGTATAAGAGAAGTAGCAATTCGTAGAAACGGTACTAATGGCT
CAACCCCTAAAACTCCATTTCTTACATATTTCATTGGGAAACAATTAAATATTGATCTCT
GTTTTCTCTCCATGGAGGCAATATTGATCTATACAGAGTAATATTGATCAATATTGATCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATT

Last Updated on 07.07.2016 14:16