Sequences from confirmation amplicon


Confirmation sequences for line 039G02 and hit At2g29490 are shown.
Line ID 039G02
Locus At2g29490 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:12631566
Primers used for PCR NK14 - 8474, show primer details
   
Sequence Name 18-K102590-0022-039-G02C-8409
GenBank Accession LN494253 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K102590-0022-039-G02C-8409
GGAATGAGCATGTAGATTTTTCTTTTTCGTAGGCAAGAAGTATCTTTAATTTAGGCAGAC
TTAATTGTCTCTGCAATTTTGGTCATGCGCTCAATTTGTTTCTCTCTTGGAGGAATACAT
CCCCTCACTGCCTCAACTTCTTCCAAATTCTTGATCCATCTATTTAATTCCGGAAACTTC
TCCTCTGGAATCATATCAATTCCAATACCTTTCCAAAGTCTAGCTAGACAAAATGGGATC
ATACTTCCTGCGATCATGTCCAAGAATCCGATTGTCTTGCCACCGAAGAAATCTTTTCCA
GTGACTTCTTTCTCAAGAAACATAAGCAGTTCCCGAGTCTCTTCAATAGCAACCTCTCTT
CCTTTCTCTGCTTTTACAAGGGACCTAAACCCTAGTGTTAGGATCTGCAAGTAAAGAACA
ATATATAAACAAGCGAATAATATAATATTGTTCTGCATAGAATCAACTAATTAATCTGCA
AATCAATATTAGTATACCTGGTCATCGATGAACTTGGCCCAAAATCGAGCCATGGCCTTC
TCGTAAGGATCTTGAGGAAGAATTGAAATGTTC
   
Sequence Name 18-K102591-0022-039-G02C-NK14
GenBank Accession LN494254 [GenBank]
Sequencing primer gene specific primer, NK14: 5'-AAGAACAGTCCAATTCTTCCTCAA-3'
Sequence (A. th genome BLAST matches underlined)
>18-K102591-0022-039-G02C-NK14
CATGGCTCGATTTTGGGCCAGTTCATCGATGACCAGGTATACTAATATTGATTTGCAGAT
TAATTAGTTGATTCTATGCAGAACAATATTATATTATTCGCTTGTTTATATATTGTTCTT
TACTTGCAGATCCTAACACTAGGGTTTAGGTCCCTTGTAAAAGCAGAGAAAGGAAGAGAG
GTTGCTATTGAAGAGACTCGGGAACTGCTTATGTTTCTTGAGAAAGAAGTCACTGGAAAA
GATTTCTTCGGTGGCAAGACAATCGGATTCTTGGACATGATCGCAGGAAGTATGATCCCA
TTTTGTCTAGCTAGACTTTGGAAAGGTATTGGAATTGATATGATTCCAGAGGAGAAGTTT
CCGGAATTAAATAGATGGATCAAGAATTTGGAAGAAGTTGAGGCAGTGAGGGGATGTATT
CCTCCAAGAGAGAAACAAATTGAGCGCATGACCAAAATTGCAGAGACAATTAAGTCTGCC
TAAATTAAAGATACTTCTTGCCTACGAAAAAGAAAAATCTACATGGCTTCATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTAC
ATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAAT
TATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16