Sequences from confirmation amplicon


Confirmation sequences for line 046H03 and hit At5g66220 are shown.
Line ID 046H03
Locus At5g66220 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:26461513
Primers used for PCR MR94 - 8474, show primer details
   
Sequence Name 45-K017449-022-046-H03C-MR94
GenBank Accession LN505363 [GenBank]
Sequencing primer gene specific primer, MR94: 5'-TTTTCTCCCCAATATCACTTTGTC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K017449-022-046-H03C-MR94
CCATCCTATCATTTCCCCATCCAATCTCCTTTAAAAATAAAAATAAAATTGGATTTATTT
CTTTCAGTAAAAATGAAAAAGTTGTAAATTAGTATAGTCTTCATTAATGTTCATGGACCT
TGATTATAAATAAATGTCAAAAAATGAAACTAGACTTGAGTTGGTCTTCCTCGTCGCCCA
TGCCGCTGCCTTCCGTGACGCCACTCCACGTCGACGCATTTACTTTTCCTCCGGCTGTTG
AGTCGCCCGCTTCCCACAAAAGACTTTTCCTCGGTGGTGCAGGTTAGCATCATAGTCTGT
CTATACAATTAATGCACACAGCAGCATTATGTGGCTAATTACCTTTAATCACGCAGGGAT
ATGATGGTTTGATATTAAAGGCAAGTTCGTGATTGTGACGGTCATCGGAGTCTACCTTGA
AGCCATGGCACTGCCGTCAATCTCCGCTAAGTGGAAAGGCAAGAATGCAAAGGAGTTGAC
GGAATCCGTCCCTTTCTTCCGCCAACTCGTCACAGGATATATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGCAATATTGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACA
   
Sequence Name 46-K017449-022-046-H03C-8409
GenBank Accession LN505712 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K017449-022-046-H03C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTGACGAGTTGG
CGGAAGAAAGGGACGGATTCCGTCAACTCCTTTGCATTCTTGCCTTTCCACTTAGCGGAG
ATTGACGGCAGTGCCATGGCTTCAAGGTAGACTCCGATGACCGTCACAATCACGAACTTG
CCTTTAATATCAAACCATCATATCCCTGCGTGATTAAAGGTAATTAGCCACATAATGCTG
CTGTGTGCATTAATTGTATAGACAGACTATGATGCTAACCTGCACCACCGAGGAAAAGTC
TTTTGTGGGAAGCGGGCGACTCAACAGCCGGAGGAAAAGTAAATGCGTCGACGTGGAGTG
GCGTCACGGAAGGCAGCGGCATGGGCGACGAGGAAGACCAACTCAAGTCTAGTTTCATTT
TTTGACATTTATTTATAATCAAGGTCCATGAACATTAATGAAGACTATACTAATTTACAA
CTTTTTCATTTTTACTGAAAGAAATAAATCCAATTTTATTTTTATTTTTAAAGGAGATTG
GATGGGGAAATGATAGGATGGAAATGCATGCGACAAAGTGATAT

Last Updated on 07.07.2016 14:16