Sequences from confirmation amplicon


Confirmation sequences for line 049D04 and hit At4g34890 are shown.
Line ID 049D04
Locus At4g34890 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16622852
Primers used for PCR FB01 - 8474, show primer details
   
Sequence Name 17-K020608-022-049-D04C-8409
GenBank Accession LN493677 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K020608-022-049-D04C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCAGCAATAATGCAATT
GCTGATCCATGTAGATTTCTGGGGGAATGGTGGAGTTTCGGAAATCTCTAACCCTAAGCT
TCTTCTTTAAATTTTTCTTATGGGTTTCTCATAATGTCAATAATGCAAATTCTGCGATAG
AGACCTTCCCACCCTCCCATATGTCAGCTGTGCAACCTGTTCCTCGGTTATCTAGAATTG
GAAAACAAGACTATGAGACAGTAAAGCAGGGAACATCTGTTGGCTCGTCGGAGGTGCATC
TTTCAGCGAGAATGCAGGTATGTTGGTCCATTTACCCAAATTGGTTCTCCACTTTGATTC
TCATTCTGGTTGTTTTCTTAG
   
Sequence Name 18-K020608-022-049-D04C-FB01
GenBank Accession LN494124 [GenBank]
Sequencing primer gene specific primer, FB01: 5'-GGCTAAGAAAACAACCAGAATGAG-3'
Sequence (A. th genome BLAST matches underlined)
>18-K020608-022-049-D04C-FB01
AAAGTGGAGAACCAATTTGGGTAAATGGACCAACATACCTGCATTCTCGCTGAAAGATGC
ACCTCCGACGAGCCAACAGATGTTCCCTGCTTTACTGTCTCATAGTCTTGTTTTCCAATT
CTAGATAACCGAGGAACAGGTTGCACAGCTGACATATGGGAGGGTGGGAAGGTCTCTATC
GCAGAATTTGCATTATTGACATTATGAGAAACCCATAAGAAAAATTTAAAGAAGAAGCTT
AGGGTTAGAGATTTCCGAAACTCCACCATTCCCCCAGAAATCTACATGGATCAGCAATTG
CATTATTGCTGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTC
GGAAATCTTTATTTCGACGTGTCTACATTC
Primers used for PCR FM05 - 8474, show primer details
   
Sequence Name 39-K029744-022-049-D04C-8409
GenBank Accession LN503240 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K029744-022-049-D04C-8409
GCCATTTACAATTGAATATATCCTGGGAAATCTACACATCCATGTAATCGATTTATAATT
ACTTCCTTAATCACGACATCGCTCTGTATGACCTTAAGCGCATCCTGCAGAAGATCTTTA
TTCCAATTCTTTCCAATTAGAAACTCTTCAGTCTTTCTCGCACACAAAGAAAGAGGAGCC
ACACCTCCATAAGCAATGGATGCATCAGAAACGAACAATTGTTGACCCTTGTCTTCAAGA
AACACACGCATTCCACCATTGACAATAGCTATATCATCATCCCTGCGATGGGCCTGCTTA
AATTCTTTCACATACTCTAAGGGTCTTGTCCATGGAAGGAATACCGACAACAAGATCTCG
TTGCTCCCCATATCCACTTTACGATAACCGAGGAAGAAATCTTTTGCAGGTATAGACCTA
ACATCTCCATTGCAGTTGGTTATCCGAAACTCTGCTCTTGAAGCCATCCAAAG
   
Sequence Name 40-K029744-022-049-D04C-FM05
GenBank Accession LN503593 [GenBank]
Sequencing primer gene specific primer, FM05: 5'-ATTTAAATCCTCTTTGGATGGCTT-3'
Sequence (A. th genome BLAST matches underlined)
>40-K029744-022-049-D04C-FM05
AACACTGCATGGAGATGTTAGGTCTATACCTGCAAAAGATTTCTTCCTCGGTTATCGTAA
AGTGGATATGGGGAGCAACGAGATCTTGTTGTCGGTATTCCTTCCATGGACAAGACCCTT
AGAGTATGTGAAAGAATTTAAGCAGGCCCATCGCAGGGATGATGATATAGCTATTGTCAA
TGGTGGAATGCGTGTGTTTCTTGAAGACAAGGGTCAACAATTGTTCGTTTCTGATGCATC
CATTGCTTATGGAGGTGTGGCTCCTCTTTCTTTGTGTGCGAGAAAGACTGAAGAGTTTCT
AATTGGAAAGAATTGGAATAAAGATCTTCTGCAGGATGCGCTTAAGGTCATACAGAGCGA
TGTCGTGATTAAGGAAGTAATTATAAATCGATTACATGGATGTGTAGATTTCCAGGATAT
ATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAT
GTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGT
CGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACG
TGTCTAC

Last Updated on 07.07.2016 14:16