Sequences from confirmation amplicon


Confirmation sequences for line 062A09 and hit At2g34490 are shown.
Line ID 062A09
Locus At2g34490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14537384
Primers used for PCR KH04 - 8474, show primer details
   
Sequence Name 39-K025675-022-062-A09C-8409
GenBank Accession LN503222 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K025675-022-062-A09C-8409
GTAGATTTCCCGGACATGAAGCCATTTACATGNGAAAAAAAAGGATGGTTTTCTCAGTTT
CCATTTTTGCCTCTCTCGCTCCGTACTTAGTCTCTGCGTTACTACTCTTCTTTCTCATCG
AGCAGCTCTCTTACCTCGTCAAGAAACGTAACCTCCCTGGTCCTCTCTTTGTCCCTCCGA
TCATCGGAAACGCCATTTCACTCGTCCGTGATCCTACTTCCTTCTGGTTCAAGCAATCCG
ACACGGCAGGCACTTCCCCTGGCCTCGCTGCTAACTACCTCATCGGCAAATTCATCATCT
ACATCAGAGACACAGAGCTTTCTCATCAAATATTCTCCAACGTTCGTCTTGAAGCTTTTC
ACCCTCTAGGACATCCTTTTGGCAAACAACTATTCGGTGATCATAGCCTAATCTACTTGT
TTGGTG
   
Sequence Name 40-K025675-022-062-A09C-KH04
GenBank Accession LN503577 [GenBank]
Sequencing primer gene specific primer, KH04: 5'-TTGTGATCCTCACCAAACAAGTAG-3'
Sequence (A. th genome BLAST matches underlined)
>40-K025675-022-062-A09C-KH04
AGGCTATGATCACCGAATAGTTGTTTGCCAAAAGGATGTCCTAGAGGGTGAAAAGCTTCA
AGACGAACGTTGGAGAATATTTGATGAGAAAGCTCTGTGTCTCTGATGTAGATGATGAAT
TTGCCGATGAGGTAGTTAGCAGCGAGGCCAGGGGAAGTGCCTGCCGTGTCGGATTGCTTG
AACCAGAAGGAAGTAGGATCACGGACGAGTGAAATGGCGTTTCCGATGATCGGAGGGACA
AAGAGAGGACCAGGGAGGTTACGTTTCTTGACGAGGTAAGAGAGCTGCTCGATGAGAAAG
AAGAGTAGTAACGCAGAGACTAAGTACGGAGCGAGAGAGGCAAAAATGGAAACTGAGAAA
ACCATCCTTTTTTTTCCATGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
TTATTTCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25