Sequences from confirmation amplicon


Confirmation sequences for line 062D03 and hit At5g67540 are shown.
Line ID 062D03
Locus At5g67540 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:26945386
Primers used for PCR LJ01 - 8474, show primer details
   
Sequence Name 21-K021852-022-062-D03C-8409
GenBank Accession LN495482 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K021852-022-062-D03C-8409
TGAGCCATTTACATTGAATATNGGGAAAGAAAAGATGTCGAATTGGTGACTTGTCGTCAA
GAAACTCCTCAACGAGAGGGATCGGTTTTCTTGATCTCCGTTTACTAGTACGAGGAGAAC
GCTTCCTAGGTGGCGGCATTCTCAGGACCTCTTCTTCAACTCTTATAAGTTCACGAACAA
TAGGATGAGCAAGATGATGTACTACTTGTAACTGATCTGAAGAAACTTGTTGATGGATGT
TGTTATCTTTTCTGCTATACAGAGAGATAAGATGAGCCACCAGGAAAAACCCGACGACGG
TCCAAACAATAGTAAGCAATGAATATCTGCAACCTCCTGCATCATTGCAATGCAAAGATG
TTGATTTCTTATTGTATTTGTTGTTCTTCTTCATTATCCTCTTTATGTCTTCTAAAACAC
TGTAAATATACAAAACCCAACTTCTGTAGATCCAAAACATAACTCTAGTGCAACAAAATT
TGAAGTCTTAGATTCAACAACTCTAAATCAGTAGATTAGTAAAATTAAGCTACCAGAGAT
CAAATATATATCAGATCCGAAGCTAACATCCAAATGAATAAAACCTTAACCC
   
Sequence Name 22-K021852-022-062-D03C-LJ01
GenBank Accession LN495930 [GenBank]
Sequencing primer gene specific primer, LJ01: 5'-TGCTTCGTATTCTTAGGGTTAAGG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K021852-022-062-D03C-LJ01
TGATATATATTTGATCTCTGGTAGCTTAATTTTACTAATCTACTGATTTAGAGTTGTTGA
ATCTAAGACTTCAAATTTTGTTGCACTAGAGTTATGTTTTGGATCTACAGAAGTTGGGTT
TTGTATATTTACAGTGTTTTAGAAGACATAAAGAGGATAATGAAGAAGAACAACAAATAC
AATAAGAAATCAACATCTTTGCATTGCAATGATGCAGGAGGTTGCAGATATTCATTGCTT
ACTATTGTTTGGACCGTCGTCGGGTTTTTCCTGGTGGCTCATCTTATCTCTCTGTATAGC
AGAAAAGATAACAACATCCATCAACAAGTTTCTTCAGATCAGTTACAAGTAGTACATCAT
CTTGCTCATCCTATTGTTCGTGAACTTATAAGAGTTGAAGAAGAGGTCCTGAGAATGCCG
CCACCTAGGAAGCGTTCTCCTCGTACTAGTAAACGGAGATCAAGAAAACCGATCCCTCTC
GTTGAGGAGTTTCTTGACGACAAGTCACCAATTCGACATCTTTTCTTTCCCATATTCAAT
TGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATA
TGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCA
GCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTT
ATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA

Last Updated on 23.10.2014 13:25