Sequences from confirmation amplicon


Confirmation sequences for line 072B04 and hit At2g31865 are shown.
Line ID 072B04
Locus At2g31865 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13548459
Primers used for PCR BD22 - 8474, show primer details
   
Sequence Name 10-K027846-022-072-B04C-8409
GenBank Accession LN490509 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K027846-022-072-B04C-8409
GGATGAGCCTTTACATTTAATTGCTGTCCCGGACACCGGCTTTGTTTCATTCGAGAGGAA
AATTCTTCCACTGGAATACCATCCTCACTTTGTTTCTTATCCCAAGGCTGATTCGTGGGC
TAATTCTGTCACCCCACTTTGCTCCATTGAGGTATCATAGAAACACTCCTAGTTAAGCCT
TCTTCGCCGTTGAATCCATTTCTTTCAGATGATTCATGAGTATGCTTTAGGTTATTCTCC
TTTTGATCCATTTTTTATTGGAGTAGATTCACACCTCGGGAGCTATAGAAGATCAACCTT
GTGAAGCTCTTGAAGTAGATTTTGCAGATGAGTATTTTGGAGGCCTTACTCTGAGTTATG
ATACTCTACAGGTCTGACTTGTACTTCCTTTTCTTCCATCTCTTCTAAAAACTCTACTAT
CTCATCCACTAAATAAGTTATAAGTTTTTCTTATTTCAAAATATGTTGAACATGTCAAAA
TATACCTATGTAGGAAGAAATAAGGTTCGTGATCAACCCGGAACTTATCGCTGGCATGAT
CTTTTTGCCTCGTATGGATGCAAATGAAGCAATTGAGATTGTTGGTGT
   
Sequence Name 11-K027846-022-072-B04C-BD22
GenBank Accession LN490967 [GenBank]
Sequencing primer gene specific primer, BD22: 5'-CTGAAAATCTTTCAACACCAACAA-3'
Sequence (A. th genome BLAST matches underlined)
>11-K027846-022-072-B04C-BD22
CTACGAGGCAAAAGATCATGCCAGCGATAAGTTCCGGGTTGATCACGAACCTTATTTCTT
CCTACATAGGTATATTTTGACATGTTCAACATATTTTGAAATAAGAAAAACTTATAACTT
ATTTAGTGGATGAGATAGTAGAGTTTTTAGAAGAGATGGAAGAAAAGGAAGTACAAGTCA
GACCTGTAGAGTATCATAACTCAGAGTAAGGCCTCCAAAATACTCATCTGCAAAATCTAC
TTCAAGAGCTTCACAAGGTTGATCTTCTATAGCTCCCGAGGTGTGAATCTACTCCAATAA
AAAATGGATCAAAAGGAGAATAACCTAAAGCATACTCATGAATCATCTGAAAGAAATGGA
TTCAACGGCGAAGAAGGCTTAACTAGGAGTGTTTCTATGATACCTCAATGGAGCAAAGTG
GGGTGACAGAATTAGCCCACGAATCAGCCTTGGGATAAGAAACAAAGTGAGGATGGTATT
CCAGTGGAAGAATTTTCCTCTCAAATGAAACAAAGCCGGTGTCCGGGACAGCAATTTAAA
TGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATA
TGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCA
GCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTT
ATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCT
Primers used for PCR AB82 - 8474, show primer details
   
Sequence Name 38-K011908-0022-072-B04C-3144
GenBank Accession LN502800 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>38-K011908-0022-072-B04C-3144
TCCCGGACATGAAGCCATTTACATTTAAATTGCTGTCCCGGACACCGGCTTTGTTTTATT
TGAGAGGAAAATTCTTCCACTGGAATACCATCCTCACTTTGTTTCTTATCCCAAGGCTGA
TTCGTGGGCTAATTCTGTCACCCCACTTTGCTCCATTGAGGTATCATAGAAACACTCCTA
GTTAAGCCTTCTTCGCCGTTGAATCCATTTCTTTCAGATGATTCATGAGTATGCTTTAGG
TTATTCTCCTTTTGATCCATTTTTTATTGGAGTAGATTCACACCTCGGGAGCTATAGAAG
ATCAACCTTGTGAAGCTCTTGAAGTAGATTTTGCAGATGAGTATTTTGGAGGCCTTACTC
TGAGTTATGATACTCTACAGGTCTGACTTGTACTTCCTTTTCTTCCATCTCTTCTAAAAA
CTCTACTATCTCATCCACTAAATAAGTTATAAGTTTTTCTTATTTCAAAATATGTTGAAC
ATGTCAAAATATACCTATGTAGGAAGAAATAAGGTTCGTGATCAACCCGGAACTTATCGC
TGGCATGATCTTTTTGCCTCGTATGGATGCAAATGAAGCAATTGAGATTGTTGGTGTTGA
AAGATTTTCAGGTTATACAGGGTAAGTACCAATGAACTGAAGTAGATGTGTTTATTGGGT
CTTCAAAGTTGATATTAAGCTTATTATATAGTCTTCTCTCTAAATCCAACTCA

Last Updated on 07.07.2016 14:16