Sequences from confirmation amplicon


Confirmation sequences for line 073F01 and hit At1g78540 are shown.
Line ID 073F01
Locus At1g78540 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29544061
Primers used for PCR XD04 - 8474, show primer details
   
Sequence Name 63-K021645-022-073-F01C-8409
GenBank Accession LN510882 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>63-K021645-022-073-F01C-8409
GATTTCCCGGACATGATTCAACAACATCTACATTAAATCAGAGATAAAGAACAAAGTGAA
CCAATCCTATTTCCAACTAAATCTCTATATAAACAATAAAACAGAGAACTGGGCTTTCAA
AACTTTACTCGAATACCTCACAACCAACTCAAATTTCATTTCTTTGTCACAGATACAAAC
AATCGAGGACGATAAATCACACCAAAGTCAAAAAGTTTGTAAATTTAGTACACAGGACTA
TAGGAGAATCAAACAAGTTACAGAACTAAGAGAGAAACAAACCAAGTCCGATGAATAAAG
AAGGAACATTTCAGCAAACACCATGAGAAACAATAAAAAGAAGCTTTGATTGGATTCTGG
GGAAAATCACCTGTCTAATGATGGTAGATGGGAATGTGGTGGAATTAAGAAGATAAACCC
AGAAACAAAGGG
   
Sequence Name 64-K021645-022-073-F01C-XD04
GenBank Accession LN511102 [GenBank]
Sequencing primer gene specific primer, XD04: 5'-TACGAAAGTTTCTCCCTTTGTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K021645-022-073-F01C-XD04
TCTACCATCATTAGACAGGTGATTTTCCCCAGAATCCAATCAAAGCTTCTTTTTATTGTT
TCTCATGGTGTTTGCTGAAATGTTCCTTCTTTATTCATCGGACTTGGTTTGTTTCTCTCT
TAGTTCTGTAACTTGTTTGATTCTCCTATAGTCCTGTGTACTAAATTTACAAACTTTTTG
ACTTTGGTGTGATTTATCGTCCTCGATTGTTTGTATCTGTGACAAAGAAATGAAATTTGA
GTTGGTTGTGAGGTATTCGAGTAAAGTTTTGAAAGCCCAGTTCTCTGTTTTATTGTTTAT
ATAGAGATTTAGTTGGAAATAGGATTGGTTCACTTTGTTCTTTATCTCTGATTTAATGTA
GATGTTGTTGAATCATGTCCGGGAAATCTACATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTC
GGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16