Sequences from confirmation amplicon


Confirmation sequences for line 076F06 and hit At5g53530 are shown.
Line ID 076F06
Locus At5g53530 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:21747114
Primers used for PCR MA34 - 8474, show primer details
   
Sequence Name 01-K101499-0022-076-F06C-8409
GenBank Accession LN486510 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K101499-0022-076-F06C-8409
ACTTGTGTGTATATATATCTTCGTGACACAATAGTCCTTAAGATAAACTTAGCTCTTTTT
TAATTGGTTTGAAACAGGTCCGTAACTATGTTCCGCTTCCTCCAATCAATAATAGCATTA
AGGTGAGTTCTGATATGATTCAAGTTTACTGATTTCTTACCGCTCTTGCTTTTGATAGTG
AATGGCCTTTTGATATTCCATTTCCTTATTAGCATTAGATACGCTTAATTCCATTGGACC
CTTACCCATTGTACAGATGGAAGTTGGAATCGAGGACTGTCTGCATATCGAGTTTGAGTA
CAATAAAAGCAAGTAAGATAAACTGATTTTCGTAACTTTGGGTTTCGAGCGATGTGGAAA
ATATAAAACAGTAGCTAATTCTGTATGCTCTCGATGCAGGTATCACCTAAAAGATGTTAT
CCTTGGGAAAATATACTTTCTTCTGGTGAGAATCAAGATAAAGAATATGGATCTTGAGAT
AAGACGGCGAGAATCAACTGGAGCAGGAGCTAATACTCACGTCGAAACAGAAACACTAGC
CAAATTTGAGTTAATGGATGGTGCTCCAGTTAGAAGTATGTATATTCATCATATGTTACA
AAACTCAATCGGACCTATTACTAGTTTCTGTAACCAAGTATTGAGACCATTGTTGCANGC
GAATCGATACCTGTTAGAGTGTTCTTGA
   
Sequence Name 01-K101503-0022-076-F06C-MA34
GenBank Accession LN486511 [GenBank]
Sequencing primer gene specific primer, MA34: 5'-GATCGTATGGTGTCAAGAACACTC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K101503-0022-076-F06C-MA34
TCTCATACTTGGTTACGAAACTAGTAATAGGTCCGAATGAGTTTTGTAACATATGATGAA
TATACATACCTCTAACTGGAGCACCATCCATTAACTCAAATTTGGCTAGTGTTTCTGTTT
CGACGTGAGTATTAGCTCCTGCTCCAGTTGATTCTCGCCGTCTTATCTCAAGATCCATAT
TCTTTATCTTGATTCTCACCAGAAGAAAGTATATTTTCCCAAGGATAACATCTTTTAGGT
GATACCTGCATCGAGAGCATACAGAATTAGCTACTGTTTTATATTTTCCACATCGCTCGA
AACCCAAAGTTACGAANATCAGTTTATCTAACTTGCTTTTATTGTACTCAAACTCGATAT
GCAGACAGTCCTCGATTCCNACTTCCATCTGTACAATGGGTAAGGGTCCAATGGAATTAA
GCGTATCTNATGCTAATAAGGAAATGGAATATCAAAAGGCCATTCACTATCANAAGCAAG
AGCGGTAAGAAATCAGTAAACTTGAATCATATCAAAACTCACCTTAATGCTNTNATTGAT
TGGAGGAAGCGGAACATAGTTACGGACCTGTTTCAAACCAATTAAAAAAGAGCTAAGTTT
ATCTTAAGGACTATNGTGTCACGA

Last Updated on 23.10.2014 13:25