Sequences from confirmation amplicon


Confirmation sequences for line 077A12 and hit At5g04820 are shown.
Line ID 077A12
Locus At5g04820 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:1399407
Primers used for PCR CK40 - 8474, show primer details
   
Sequence Name 18-K018063-022-077-A12C-CK40
GenBank Accession LN494105 [GenBank]
Sequencing primer gene specific primer, CK40: 5'-CTGTCTCGGACGAGTTAGTAAACC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K018063-022-077-A12C-CK40
CAACAAATCTCCTCCATTGTTGTTGTTGTGGTGGTGGTCGAAGAAAACAGAGTTCACCGT
CTTGATCATGTCGTCGCCGACTCGGAACGAAAGAGTTTTGGCATTGTAACAGAGAGGAAC
CGCTAGTAATCCTCCGGCTCCGCCTTTGAACAGAGAAGAGAGTTTCATCTTCTTCTTCCC
CATTGATACCACCAATTGTTTTTTTCTTTGTGAAGATCTTTGGTTGGGTTTGGGTTTAGT
AATTAATGGAAGAGGAAGGAGTTGGAGGGAATGCGATATATGGGGAGAGAAGAGAGAGCT
GGTGGGGTCAGGTCATGTGTCTATTTAATTTTGGGATATTTTTCTATTTGTTGTTAATTT
TCCATTTTTTTCTGGTTAGTTATTTGAAGTGCTTTTACTTATTTAGTCTAAAGTCTTAAC
TATAAAAATTACGATGATTGAAGTTGATAGTTTGTTTTTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
   
Sequence Name 22-K018063-022-077-A12C-8409
GenBank Accession LN495907 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K018063-022-077-A12C-8409
GCCATTTACAAAAACAAACTATCAACTTCAATCATCGTAATTTTTATAGTTAAGACTTTA
GACTAAATAAGTAAAAGCACTTCAAATAACTAACCAGAAAAAAATGGAAAATTAACAACA
AATAGAAAAATATCCCAAAATTAAATAGACACATGACCTGACCCCACCAGCTCTCTCTTC
TCTCCCCATATATCGCATTCCCTCCAACTCCTTCCTCTTCCATTAATTACTAAACCCAAA
CCCAACCAAAGATCTTCACAAAGAAAAAAACAATTGGTGGTATCAATGGGGAAGAAGAAG
ATGAAACTCTCTTCTCTGTTCAAAGGCGGAGCCGGAGGATTACTAGCGGTTCCTCTCTGT
TACAATGCCAAAACTCTTTCGTTCCGAGTCGGCGACGACATGATCAAGACGGTGAACTCT
GTTTTCTTCGACCACCACCACAACAACAACAATGGAGGAGATTTGTTGGAAGCGGAGACG
CCTGAGTCATGGTTTACTAACTC

Last Updated on 23.10.2014 13:25