Sequences from confirmation amplicon


Confirmation sequences for line 081B12 and hit At5g16530 are shown.
Line ID 081B12
Locus At5g16530 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:5401292
Primers used for PCR KP04 - 8474, show primer details
   
Sequence Name 10-K021167-022-081-B12C-8409
GenBank Accession LN490456 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K021167-022-081-B12C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATTGAAGTCGTTCCTTGAGGTCATGTCCC
TCGTTTGGTTGAAGCTTGCAACGAATCCAAATTGCTATTCTTGCATCCTTGGGATCGCAT
GGGCTTTTATTTCTAACAGGTAAAAATGAATCTTTAATTAAACTTTATATTGGTACCTAT
AAGATGTTTAACAAAGTGTTAATTAGTATGTGTGATCAGGGACTCAGGAGACTACATTAA
TTCCACCCCTTACTCCGAGGCAACCGTTAAAATTGCCTAAAAATATCTATAGTTTGACGT
TTAAACCATCTAAATTATTACTTTTCTGTGTAGCGCCTGATGATCTATAGTTAAAATTTT
GACAGAAATATAGGTCACGATTGTTTCTTTGCATTTGCGTTTATATTTCCATGTGACAAA
TGACTAGGACATTTTTAACATGGTAACATAATTTGCAAACGTGACATGTACATGCAAATA
AACTAATCATGATTTTAATCTGAATATTAGAGTCTTTGACCAAATTTCTATTTTATTTGT
TTTAGTGTGAATTTTGGGTT
   
Sequence Name 14-K021167-022-081-B12C-KP04
GenBank Accession LN492310 [GenBank]
Sequencing primer gene specific primer, KP04: 5'-ACACTAATCAAAACCCTAAACCCA-3'
Sequence (A. th genome BLAST matches underlined)
>14-K021167-022-081-B12C-KP04
TCACACTAAAACAAATAAAATAGAAATTTGGTCAAAGACTCTAATATTCAGATTAAAATC
ATGATTAGTTTATTTGCATGTACATGTCACGTTTGCAAATTATGTTACCATGTTAAAAAT
GTCCTAGTCATTTGTCACATGGAAATATAAACGCAAATGCAAAGAAACAATCGTGACCTA
TATTTCTGTCAAAATTTTAACTATAGATCATCAGGCGCTACACAGAAAAGTAATAATTTA
GATGGTTTAAACGTCAAACTATAGATATTTTTAGGCAATTTTAACGGTTGCCTCGGAGTA
AGGGGTGGAATTAATGTAGTCTCCTGAGTCCCTGATCACACATACTAATTAACACTTTGT
TAAACATCTTATAGGTACCAATATAAAGTTTAATTAAAGATTCATTTTTACCTGTTAGAA
ATAAAAGCCCATGCGATCCCAAGGATGCAAGAATAGCAATTTGGATTCGTTGCAAGCTTC
AACCAAACGAGGGACATGACCTCAAGGAACGACTTCAATTCAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAA

Last Updated on 23.10.2014 13:25