Sequences from confirmation amplicon


Confirmation sequences for line 082D10 and hit At2g34490 are shown.
Line ID 082D10
Locus At2g34490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14537444
Primers used for PCR MS45 - 3144, show primer details
   
Sequence Name 03-K019338-022-082-D10C-3144
GenBank Accession LN487286 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K019338-022-082-D10C-3144
GATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTT
CATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAAC
TATCAGTGTTTTAAGAGAAGATCTAATAAGAAAGAAGAGGAAAAAAAAGGATGGTTTTCT
CAGTTTCCATTTTTGCCTCTCTCGCTCCGTACTTAGTCTCTGCGTTACTACTCTTCTTTC
TCATCGAGCAGCTCT
   
Sequence Name 04-K019338-022-082-D10C-MS45
GenBank Accession LN487729 [GenBank]
Sequencing primer gene specific primer, MS45: 5'-TTGTGATCCTCACCAAACAAGTAG-3'
Sequence (A. th genome BLAST matches underlined)
>04-K019338-022-082-D10C-MS45
GGCTATGATCACCGAATAGTTGTTTGCCAAAAGGATGTCCTAGAGGGTGAAAAGCTTCAA
GACGAACGTTGGAAAATATTTGATGAGAAAGCTCTGTGTCTCTGATGTAGATGATGAATT
TGCCGATGAGGTAGTTAGCAGCGAGGCCAGGGGAAGTGCCTGCCGTGTCGGATTGCTTGA
ACCAGAAGGAAGTAGGATCACGGACGAGTGAAATGGCGTTTCCGATGATCGGAGGGACAA
AGAGAGGACCAGGGAGGTTACGTTTCTTGACGAGGTAAGAGAGCTGCTCGATGAGAAAGA
AGAGTAGTAACGCAGAGACTAAGTACGGAGCGAGAGAGGCAAAAATGGAAACTGAGAAAA
CCATCCCTTTTTTTCCTCTTCTTTCTTATTAGATCTTCTCTTAAAACACTGATAGTTTAA
ACCGAAGGCGGGAAACGACAATCTGATCCCCGGGTACCCTGTCCTCT
Primers used for PCR FI32 - 8474, show primer details
   
Sequence Name 23-K028244-022-082-D10C-8409
GenBank Accession LN496425 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K028244-022-082-D10C-8409
ATCCATATACTCATTTCTTTTATATATGCAGTAAACAATATATAAGGGTATGACACTCTC
TTAGGGCCTGGCTTATTTTAACATGAAAACCAAAAATTACATAAAGGCTATATATATAAA
AGCTATGATTGTTAATACAGTTTCCACTGTAATTAGTAATTTGTCTGATACATACGTGAA
AATATATATGGTTGGTGTAACCAACTTGATGTTTTTTTTTTCTAAACATGTAAATATTAT
TAATAATGAAAATATGCTTTACAAGAAGTAATACATACACAAGTGTAGCGAAGTAAAAAA
AACAAACAAGGCTACTATATAAGAAAAAGATTTAGGAAGATTGGAATCCAAAGAAGCATG
AATGTACGCCAACTAACGTGATGTTACGACAATGACA
   
Sequence Name 24-K028244-022-082-D10C-FI32
GenBank Accession LN496866 [GenBank]
Sequencing primer gene specific primer, FI32: 5'-TGACTGTTTGATGTCATTGTCGTA-3'
Sequence (A. th genome BLAST matches underlined)
>24-K028244-022-082-D10C-FI32
CATCACGTTAGTTGGCGTACATTCATGCTTCTTTGGATTCCAATCTTCCTAAATCTTTTT
CTTATATAGTAGCCTTGTTTGTTTTTTTTACTTCGCTACACTTGTGTATGTATTACTTCT
TGTAAAGCATATTTTCATTATTAATAATATTTACATGTTTAGAAAAAAAAAACATCAAGT
TGGTTACCCCAACCATATATATTTTCACGTATGTATCAAACAAATTACTAATTACAGTGG
AAACTGTATTAACAATCATAGCTTTTATATATATAGCCTTTATGTAATTTTTGGTTTTCA
TGTTAAAATAAGCCAGGCCCTAAAAGAGTGTCATACCCTTATATATGGTTTACGGCATAT
ATAAAAAAAATGAGTATATGGATCACCAATGAGTATGATGGTCAATATGGAGAAAAAGAA
AGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAAATGTCCGCACCGTTTTTATAAA
ATGAAAGTACTTTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCA
ATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCT

Last Updated on 23.10.2014 13:25