Sequences from confirmation amplicon


Confirmation sequences for line 087B10 and hit At3g16470 are shown.
Line ID 087B10
Locus At3g16470 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:5596337
Primers used for PCR 13wh - 8474, show primer details
   
Sequence Name 46-K118301-0022-087-B10C-13wh
GenBank Accession LN506003 [GenBank]
Sequencing primer gene specific primer, 13wh: 5'-CATTCAAAGGAAAAACTTCTCAGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K118301-0022-087-B10C-13wh
GAGGCGGCAAATCGTTGGATTCCATGGAACTTCAAGTGATCTGATCCATTCTCTAGGAGC
TTATATTATTCCTTCGTCCACACCATTGACTCCTTCTTCCAATACTATTCCAGCACAAGG
TGGAGATGGTGGAGTTGCTTGGGATGATGGTGTTCACGACAGTGTCAAGAAGATATATGT
TGGACAAGGTGACTCTTGTGTGACCTATTTCAAAGCTGACTATGAAAAGGCTTCAAAGCC
TGTCCTTGGAAGTGATCATGGGAAGAAGACATTGCTTGGAGCAGAGGAGGTTGTAATCTT
GATTTCATTTTCAAATCTTGTTTTCTATAGTTATTGATCTAGAAACCTAAAGTCTTTAAT
TTTGTTGCAAAACGTGCAGTTTGTGCTTGGGTCAGGATATATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAA
AGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
   
Sequence Name 14-K118300-0022-087-B10C-8409
GenBank Accession LN492713 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K118300-0022-087-B10C-8409
TTGAATATATCCTGACCCAGCACAAACTGCACGTTTTGCAACAAAATTAAAGACTTTAGG
TTTCTAGATCAATAACTATAGAAAACAAGATTTGAAAATGAAATCAAGATTACAACCTCC
TCTGCTCCAAGCAATGTCTTCTTCCCATGATCACTTCCAAGGACAGGCTTTGAAGCCTTT
TCATAGTCAGCTTTGAAATAGGTCACACAAGAGTCACCTTGTCCAACATATATCTTCTTG
ACACTGTCGTGAACACCATCATCCCAAGCAACTCCACCATCTCCACCTTGTGCTGGAATA
GTATTGGAAGAAGGAGTCAATGGTGTGGACGAAGGAATAATATAAGCTCCTAGAGAATGG
ATCAGATCACTTGAAGTTCCATGGAATCCAACGATTTTGCCGCCTCCTAGCTCAGCTTCT
TCTCCAGAGGTTAGTCCAAACGGCTGAGAAGTTTTCCTTTTGAATG
Primers used for PCR 85wh - 8474, show primer details
   
Sequence Name 28-K118313-0022-087-B10C-85wh
GenBank Accession LN499042 [GenBank]
Sequencing primer gene specific primer, 85wh: 5'-CGAGAAACTTTTCGGGTCAC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K118313-0022-087-B10C-85wh
GGAAAACTTTTTCAGCCGTTAGGACTAACCTCTGGAGAAGAAAGCTGAGCTAGGAGGCGG
CAAAATCGTTGGATTCCATGGAACTTCAAGTGATCTGATCCATTCTCTAGGAGCTTATAT
TATTCCTTCGTCCACACCATTGACTCCTTCTTCCAATACTATTCCAGCACAAGGTGGAGA
TGGTGGAGTTGCTTGGGATGATGGTGTTCACGACAGTGTCAAGAAGATATATGTTGGACA
AGGTGACTCTTGTGTGACCTATTTCAAAGCTGACTATGAAAAGGCTTCAAAGCCTGTCCT
TGGAAGTGATCATGGGAAGAAGACATTGCTTGGAGCAGAGGAGGTTGTAATCTTGATTTC
ATTTTCAAATCTTGTTTTCTATAGTTATTGATCTAGAAACCTAAAGTCTTTAATTTTGTT
GCAAAACGTGCAGTTTGTGCTTGGGTCAGGATATATTCAATTGTAAATGGCTTCATGTCC
GGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTA
ATTACCAATTTTTTTTCAATTCAAAAATGTAGATTC
   
Sequence Name 14-K118311-0022-087-B10C-8409
GenBank Accession LN492714 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K118311-0022-087-B10C-8409
TCCTGACCCAGCACAAACTGCACGTTTTGCAACAAAATTAAAGACTTTAGGTTTCTAGAT
CAATAACTATAGAAAACAAGATTTGAAAATGAAATCAAGATTACAACCTCCTCTGCTCCA
AGCAATGTCTTCTTCCCATGATCACTTCCAAGGACAGGCTTTGAAGCCTTTTCATAGTCA
GCTTTGAAATAGGTCACACAAGAGTCACCTTGTCCAACATATATCTTCTTGACACTGTCG
TGAACACCATCATCCCAAGCAACTCCACCATCTCCACCTTGTGCTGGAATAGTATTGGAA
GAAGGAGTCAATGGTGTGGACGAAGGAATAATATAAGCTCCTAGAGAATGGATCAGATCA
CTTGAAGTTCCATGGAATCCAACGATTTTGCCGCCTCCTAGCTCAGCTTCTTCTCCAGAG
GTTAGTCCAAACGGCTGAGAAGTTTTTCCTTTGAATGTCTTGAATATAAGAGCTGTGACG
ATCTCTATCGGTGACCC
Primers used for PCR 86wh - 8474, show primer details
   
Sequence Name 76-K118354-0022-087-B10C-86wh
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, 86wh: 5'-CAATGAGAGTTCTCTTGTCATCAAC-3'
Sequence (A. th genome BLAST matches underlined)
>76-K118354-0022-087-B10C-86wh
CCCCCCCTCCCCCAATTTGGGGGTGACCCCAAAAAATCCTAACCCCCGGGAAAATTTCCC
CCCAAAACCCTTTTGGAACCCCCAATAAAATCCTAACCGCCCCTATTTTTAAAAACTTCC
AGGGGAAAACTTCCCCCCCCTTTGGACCAACCCCCGGAAAAAAACCCTAACCTGGGGGGG
GCAAAATCCTTGGATTTCCGGGAAATTCCAGGGATTTGACCCCTTCCGTTGGAATTTAAT
AAATTCCCTCCAACACCCCCGTTAACCCCCCCGGTTCAGGGGGTCCGACCCAATTGGAAC
CCCCAGGGGGTCCGGGGGGAAAATTTTGGGACCACCGGTGGCCTTAAAACCATTTAAAAA
AAGTTTTTTTTGGAACAGGGGACCCCGGGTTTTTTTTTTTCCAGTTTTATTCCCAAAAAA
ATGGGAAAATTTTTTCCCTTTAACCTGGGAACCCAACCCCTCTTGGAACCAAAGAGGGCC
CCCAATCCTTTTTTTTTTTGAAATTCCCCCAAAATTTTTTTTTTCCTTCCTTCCAAAAAT
GAAGGGTTTTTTTTTTTCCCTTTTGAAATTGACCCCAAAAACCCCCCCCCCCTTTTAAAA
TTTTACCCCCAAAAACTTTTCGGGCCCCCCAATAAAATCCCCCCCCCCTTTATTTTCCAA
AATTTCCAAGGAAAAACTTCCCCCCCCTTTGGAACACCCCCCGGGAAAAAAAACCAAACC
TGGGGGCCGCAAAACCCTTGGATTCCCGGGAACCTCCAGGGACCCGACC
   
Sequence Name 65-K118353-0022-087-B10C-8409
GenBank Accession LN511490 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>65-K118353-0022-087-B10C-8409
CCTTACATTGAATATATCCTGACCCAGCACAAACTGCACGTTTTGCAACAAAATTAAAGA
CTTTAGGTTTCTAGATCAATAACTATAGAAAACAAGATTTGAAAATGAAATCAAGATTAC
AACCTCCTCTGCTCCAAGCAATGTCTTCTTCCCATGATCACTTCCAAGGACAGGCTTTGA
AGCCTTTTCATAGTCAGCTTTGAAATAGGTCACACAAGAGTCACCTTGTCCAACATATAT
CTTCTTGACACTGTCGTGAACACCATCATCCCAAGCAACTCCACCATCTCCACCTTGTGC
TGGAATAGTATTGGAAGAAGGAGTCAATGGTGTGGACGAAGGAATAATATAAGCTCCTAG
AGAATGGATCAGATCACTTGAAGTTCCATGGAATCCAACGATTTTGCCGCCTCCTAGCTC
AGCTTCTTCTCCAGAGGTTAGTCCAAACGGCTGAGAAGTTTTTCCTTTGAATGTCTTGAA
TATAAGAGCTGTGACGATCTCTATCGGTGACCCGAAAAGTTTCTCGTAGTAAACTTTCAC
ATAGGTGATGTAGTCTTCAGGATCAATCTCAAACTGCAAAAACAAAAACACATCACTACT
AGAAAGAAAGAAAAAAAAAACTTTTGGGCAATTTCAAGAAATACAAAGATTTGTGTACCT
CCTCTGTTCCAAGTAGTGTTTGCTTCCCATGTTCAAGTGATACAATCTTACCATCTTTCT
CGTAATCAAACTTGACATAAACAACACCAGAGTCACCTTGTCCAACATAAACTTTCTTTA
CATTGTCATAAGCACCACCGTCGTCCCAAACATCTCCACCACGACNACCTTGAGCTTCCA
ATTTGGTCAGACCACC

Last Updated on 07.07.2016 14:16