Sequences from confirmation amplicon


Confirmation sequences for line 089H05 and hit At4g03550 are shown.
Line ID 089H05
Locus At4g03550 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:1575842
Primers used for PCR VL20 - 8474, show primer details
   
Sequence Name 23-K020888-022-089-H05C-8409
GenBank Accession LN496377 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K020888-022-089-H05C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCATATGTATTCATTCT
TGCATATTTTGTGCCACAGCCATTTATCAGGTGCGTCTATCAGCTCTCTGGCCTGGCTCA
GTGCAAGCAAAAGCTCATTGCACAACAAGAAACACGGCCAGCGAATAACCGTCACATCCC
AGGAATTCTTTGGCAGCTCCAGTAGCTCTACTTCACGATCAGAAACTATATCCTCTTCTC
TGAAAGCTAAGATGATTTCGTTCCAGATCAACGCAAACTTGTTGGCCTCGACCTGATTCG
ACTCAAGTTTCTTAAACGGCCTCCCAAATCCATACCTTAGCTTCAATCTGCATACAGTAC
ACAACCTCAAGTTATTACAATATTGAAAAATTTAATTATATGCAGCATCTGCGTTAACAA
AAGTAAAATTTCACAGCTTGT
   
Sequence Name 24-K020888-022-089-H05C-VL20
GenBank Accession LN496819 [GenBank]
Sequencing primer gene specific primer, VL20: 5'-TTGACTTGACTGTACAAGCTGTGA-3'
Sequence (A. th genome BLAST matches underlined)
>24-K020888-022-089-H05C-VL20
TTTACTTTTGTTAACGCAGATGCTGCATATAATTAAATTTTTCAATATTGTAATAACTTG
AGGTTGTGTACTGTATGCAGATTGAAGCTAAGGTATGGATTTGGGAGGCCGTTTAAGAAA
CTTGAGTCGAATCAGGTCGAGGCCAACAAGTTTGCGTTGATCTGGAACGAAATCATCTTA
GCTTTCAGAGAAGAGGATATAGTTTCTGATCGTGAAGTAGAGCTACTGGAGCTGCCAAAG
AATTCCTGGGATGTGACGGTTATTCGCTGGCCGTGTTTCTTGTTGTGCAATGAGCTTTTG
CTTGCACTGAGCCAGGCCAGAGAGCTGATAGACGCACCTGATAAATGGCTGTGGCACAAA
ATATGCAAGAATGAATACATATGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATNTCGACGTGTCTACAT

Last Updated on 07.07.2016 14:16