Sequences from confirmation amplicon


Confirmation sequences for line 095G12 and hit At4g38380 are shown.
Line ID 095G12
Locus At4g38380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:17974568
Primers used for PCR MM10 - 3144, show primer details
   
Sequence Name 57-K019284-022-095-G12C-MM10
GenBank Accession LN509275 [GenBank]
Sequencing primer gene specific primer, MM10: 5'-GTTTTAGTTTCTTTCACCGTCGTT-3'
Sequence (A. th genome BLAST matches underlined)
>57-K019284-022-095-G12C-MM10
TCTCCCCGCTCATCCAATTTTCTTCCCCTAAAGAACCGGAATTTAGGTCAGTTATCATCC
TCGAAGCTTTCTTTCTTTCTTTTGGTTCTAATTATATATAGACGAACTAGTAAAGTTTCG
TTTTTGCAGTGTCTGTGTGTGATGGAGTCCAGTAGAGTAGTAGTGGGTGGTGGGCTGCCC
TTGGCGAATAGGAGGAACTCTAGCTTTGCCAAACCCAAAATCCAACAAGGGACTTTTCTA
CCTCTATCTCGGATCAATAATGTCTCTGCCCCCCAAAAATGCTCCCTTCACACCAATCCA
AACCCCATGTTCCCTTTTGTTACTCGCCGCAAGAGCCAGACTAACCCTGATTGCGGTGTC
AAACACTGATAGTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGGGTACCCTGTC
CTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGAT
TGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTG
GTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGG
   
Sequence Name 53-K019284-022-095-G12C-3144
GenBank Accession LN508000 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K019284-022-095-G12C-3144
GGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATT
TCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAA
CTATCAGTGTTTGACACCGCAATCAGGGTTAGTCTGGCTCTTGCGGCGAGTAACAAAAGG
GAACATGGGGTTTGGATTGGTGTGAAGGGAGCATTTTTGGGGGGCAGAGACATTATTGAT
CCGAGATAGAGGTAGAAAAGTCCCTTGTTGGATTTTGGGTTTGGCAAAGCTAGAGTTCCT
CCTATTCGCCAAGGGCAGCCCACCACCCACTACTACTCTACTGGACTCCATCACACACAG
ACACTGCAAAAACGAAACTTTACTAGTTCGTCTATATATAATTAGAACCAAAAGAAAGAA
AGAAAGCTTCGAGGATGATAACTGACCTAAATTCCGGTTCTTTAGGGGAAGAAAATTGGA
TGAGCGTGGGAGAGAAAAGAAACGACGGTGAA
Primers used for PCR FI43 - 8474, show primer details
   
Sequence Name 02-K028243-022-075-G12C-FI43
GenBank Accession LN486898 [GenBank]
Sequencing primer gene specific primer, FI43: 5'-TTCCTTTCTGGTAAACCTTGAGAA-3'
Sequence (A. th genome BLAST matches underlined)
>02-K028243-022-075-G12C-FI43
TCTTCGGGAAATCCATTCAAAGAAATATAAGGGTGGGAAAAATTGGGAAAAAAAAAAAGC
TTTTATCAACGTATCCCTGGGGCTAAATCTTGGGCGGCAATCTTTGCAATATCTTCCGCG
ACAAAAGAAGGGGCAACCCTAAAGAGCGGAATGTTAAAAAACTTTGATATGGTATTGAAA
AGGGCCATGGAAACCCCCGCTGAACCCAACTCTACAAATCCCGCATATTGGAAAAAAGGG
GAGTCCTTAAAACTCTCAAAACAACCTCTTCCAGGGGGAAATAACCCTTGAGAAGCAAAG
GAAAAATCCCGGGCCTTCCGATGTAGGCAGTCCCCATTAACAGCGTCAAAGGATCAATAA
CTTGGCCCGCAATGGCTGGAAAAAAAAACATCCCGAGTTCCCCTTTGATATCCACGGGAC
GGGCTACCCCCGTGGGAACCCCATTAACCCCCCTAGCAAGAACGGAAACCAAAGCTTTAC
ATAGGCAAGAAACCCAAAGCAACCTGGCCAAAGAGTAACAAAGGGATAACGCCACCCCTC
AATACCCTTACGGGAGTTTGTCCCGTGAAAA
   
Sequence Name 01-K028243-022-075-G12C-8409
GenBank Accession LN486437 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K028243-022-075-G12C-8409
GTAGATTTCCCCAATTGAGTCAAGTTGGGGGAAGAAGATGACTCTTGCTCTTCACTGGAC
AAACTCCCGTAAGGCTATTGAGGTGTTGCGTTATCCCTTTGTTACTCTTTGGCCATGTTG
CTTTGCGTTTCTTGCCTATGTAATGCTTTGGTCTCCGTTCTTGCTAGGGAGGTTAATGGG
GTTCACACTGGTGTAGCACGTCCTGTCGATATCAAACGAGAACTCGTGATGCTCTCTCTT
CCAGCCATTGCTGGCCAAGCTATTGATCCTTTGACGCTGCTAATGGAGACTGCATACATC
GGAAGGCTCGGTATTTTTCCTTTGCTTCTCTAGAGTTATTTCACCATGGAAGATGTTGTT
TTGAGAGTTCTAAGGACTCCCCTTCTTTCCAATATGCAGGATCTGTAGAGTTGGGTTCAG
CTGGCGTTTCCATGGCCATTTTCAATACCATATCAAAGCTCTTCAACATTCCGCTCCTCA
GCGTTGCCACTTCTTTCGTCGCT

Last Updated on 07.07.2016 14:16