Sequences from confirmation amplicon


Confirmation sequences for line 106A05 and hit At1g28140 are shown.
Line ID 106A05
Locus At1g28140 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:9833114
Primers used for PCR RK68 - 3144, show primer details
   
Sequence Name 49-K020358-022-106-A05C-3144
GenBank Accession LN506688 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K020358-022-106-A05C-3144
GATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTT
CATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAAC
TATCAGTGTTTGAAAAGAAGGCTACAAATACAAATACAAATATAAATAACTCTACGCAAA
ATGTTATTTTCACATTGGGGTTCACTCATAAATCTGTTTTCACGTCCTTGCCCTTTCTGA
ATGATGAAAAAAAGGTTATAGTTGAAAAGCTCAAGCAAAAAAAGTTGGGGTAAAAATCTG
AATGATAGGGGAATGTTTTAAGCATCTTCAAAAACAGGTAAATATTTTGTATCCATAGAT
TCTATTTACCACTGAGGAGAAATGCTACCATAAACACAGTTTGTAGATTGTGATTAGTAG
CTTAAAAGTGACAATACAAATGCCATCAAAATGTCCATTCCCTGATTGAAAGTTGGTTGC
ATCTCATATTTTCTTTTTTGACATTCAAAAAAAAAAAAAAAAAAAAAAAGGGGGGAACCT
TGT
   
Sequence Name 53-K020358-022-106-A05C-RK68
GenBank Accession LN508007 [GenBank]
Sequencing primer gene specific primer, RK68: 5'-CTGAGGGGCAAAATATCAAAAATA-3'
Sequence (A. th genome BLAST matches underlined)
>53-K020358-022-106-A05C-RK68
AACTACAAGGGATGACTTTAAACCGGGTCCAAATCCGGGTCCGACTGAACCAGGTTGCCC
CATTTTTTTTTTTTTTTTTTTTTTTTAAGGGCAAAAAAAAAAAATAAAAAAGGCCCCCCC
CCCCCAACCGGGAAAGGGACTTTTTGGGGGCTTTTTTTTTGCCCCTTTAAACCAACAAAC
CCAAATCCAAAAACGGGGTTTTGGGAACCTTTCCCCCCCGGGGGAAAAAAAAACCTTGGG
AACCAAAATTTTCCCCGGTTCTAAAAAAGCTTAAAAACTTCCCCCTACCTTCAAAATTTT
CCCCCCACTTTTTTTGGCCCAAGTTTTCAAAAAAAACCCTTTTTTTCCCCCCCAAAAGGG
GACTTAACCGGAAAAACAATTTTTTGGGGGACCCCCAGGGGAAAAAAAACTTTTGCGGAA
AAAAAATTAAAATTGGAATTGGAATTGGAACCCCCTTTTCCAAACCCGGATTTTTAAACC
CAAGGGGGGAAAAAAAAAATTTAACCCCCGGGACCCCGGCCCCCCCCAAAAAAAAAAACC
CCCCTTAAAAAAAAAAAGGGCCTTCCAAAAAAAAGGGGAATTGGCCCCCCCCCCTCCCCC
CGGGGGAAAAACCCCCCCACCCCCCTTTTTTAAAAAACGGGGTGGAAACCTTTTTTTTTC
CCCAAAGCCCCCCCGGGGGGGG

Last Updated on 23.10.2014 13:25