Sequences from confirmation amplicon


Confirmation sequences for line 108H07 and hit At1g61060 are shown.
Line ID 108H07
Locus At1g61060 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22489003
Primers used for PCR KS09 - 8474, show primer details
   
Sequence Name 11-K023372-022-108-H07C-8409
GenBank Accession LN490929 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K023372-022-108-H07C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGACTGATCATAATACAAGATACCACTT
ATGCACATCGCCCTAATATCTCCCATAGGAAAATGAAGTGTGCAACATTCAGTCTTTCTC
CATAAGAGATTTTTGTTTCCAGACTCGAATGTGAGAACATGATACTTACCGAATTTGGGT
AAGCGACACGACGACGAGGTTATACGCAATACCTTCGACTGTTTGTCTATTGGATCATAC
CCAAAAATATATGTTTCATTTAGATATAACAACTCTTTCTTAATCTCGTTTATTCTCAGT
TTGGGCAATGCTAAAAACTCTCCTGTGATGGGATTAGAAATCACCAGCACTCTTGAATAA
TTCTTTCGATCATGTTCAAGACATAACAATCCGCCAACAGGAGGACTTGTTATAAGTAAA
CTGTTTCCACTTGTCCTATGATGAAGGGTGGCTACAAGAGACGTGTTCTCATCAGGGTTT
CGAGGCTGAGGTGAAGTGTAGAAGAACAACCCTTCTGCATTTTCGATGGTGAAAAGGATC
CGCGGTGGGGCTGGAGACATGATCGGGAACAACATGTTGTAATATGGACGACGAATTTGT
GATGACCATAGCTTTGATACGCAACGACACTGAGCTATAGACTTCACTGGCAGTTTCGAC
AAGATCTTAGCAGTGAAGAGAT
   
Sequence Name 12-K023372-022-108-H07C-KS09
GenBank Accession LN491389 [GenBank]
Sequencing primer gene specific primer, KS09: 5'-TTGATGCTATCCATGTTGATCTCT-3'
Sequence (A. th genome BLAST matches underlined)
>12-K023372-022-108-H07C-KS09
ATCTTGTCGAAACTGCCAGTGAAGTCTATAGCTCAGTGTCGTTGCGTATCAAAGCTATGG
TCATCACAAATTCGTCGTCCATATTACAACATGTTGTTCCCGATCATGTCTCCAGCCCCA
CCGCGGATCCTTTTCACCATCGAAAATGCAGAAGGGTTGTTCTTCTACACTTCACCTCAG
CCTCGAAACCCTGATGAGAACACGTCTCTTGTAGCCACCCTTCATCATAGGACAAGTGGA
AACAGTTTACTTATAACAAGTCCTCCTGTTGGCGGATTGTTATGTCTTGAACATGATCGA
AAGAATTATTCAAGAGTGCTGGTGATTTCTAATCCCATCACAGGAGAGTTTTTAGCATTG
CCCAAACTGAGAATAAACGAGATTAAGAAAGAGTTGTTATATCTAAATGAAACATATATT
TTTGGGTATGATCCAATAGACAAACAGTCGAAGGTATTGCGTATAACCTCGTCGTCGTGT
CGCTTACCCAAATTCGGTAAGTATCATGTTCTCACATTCGAGTCTGGAAACAAAAATCTC
TTATGGAGAAAGACTGAATGTTGCACACTTCATTTTCCTATGGGAGATATTAGGGCGATG
TGCATAAGTGGTATCTTGTATTATGATCAGTCAATTGTAAATGGCTTCATGTCCGGGAAA
TCTACATGGAT

Last Updated on 07.07.2016 14:16