Sequences from confirmation amplicon


Confirmation sequences for line 109A06 and hit At5g20360 are shown.
Line ID 109A06
Locus At5g20360 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:6882371
Primers used for PCR CK12 - 8474, show primer details
   
Sequence Name 57-K017716-022-109-A06C-CK12
GenBank Accession LN509268 [GenBank]
Sequencing primer gene specific primer, CK12: 5'-AAGAAAAGTATGAAGAGGCCATGA-3'
Sequence (A. th genome BLAST matches underlined)
>57-K017716-022-109-A06C-CK12
AAGCCAGAGTGTTTTGAAGTCTTTCTGGCACTAGGTCTGCAGCAGTTTGAGGAAGCAAGA
CTTTCATGGTATTATGTACTTGTCAGTCACCTTGATTTGAAAACATGGCCGTATGCAGAT
GTAGTACAGTTTTATCAAAGCGCAGAAAGCAATATCAAAAAGTCTATGGAAGTGTTAGAA
AATTTGGAAACCGGAAAGGAAAGTGAGCCTTCTCAAGCAGGCAAAACCGATTGCCTGACA
CATGAAAAGGATCTGGGTAGCTCAACTCAAAATAACCCAGCAAAAGAAGCAGGAAGGCTA
AAGTCGTGGATAGATATTTTATTGTGTGCTGTACTTTATGAGAGATCAATCATGGAGTAC
AAACTTGACCAACCGTTCTGGCGAGAGAGTTTAGAAGCTGCAATGGAGAAATTTGAGTTA
GCTGGAACTTGTAAGGATGATGTTGTTGAGATAATAAGTGAAGATTATGTGGCAGGCAAT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTC
TAATTCGGAAATCTTTATTTCGACGTGTCTAC
   
Sequence Name 58-K017716-022-109-A06C-8409
GenBank Accession LN509571 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>58-K017716-022-109-A06C-8409
TATTGCCTGCCACATAATCTTCACTTATTATCTCAACAACATCATCCTTACAAGTTCCAG
CTAACTCAAATTTCTCCATTGCAGCTTCTAAACTCTCTCGCCAGAACGGTTGGTCAAGTT
TGTACTCCATGATTGATCTCTCATAAAGTACAGCACACAATAAAATATCTATCCACGACT
TTAGCCTTCCTGCTTCTTTTGCTGGGTTATTTTGAGTTGAGCTACCCAGATCCTTTTCAT
GTGTCAGGCAATCGGTTTTGCCTGCTTGAGAAGGCTCACTTTCCTTTCCGGTTTCCAAAT
TTTCTAACACTTCCATAGACTTTTTGATATTGCTTTCTGCGCTTTGATAAAACTGTACTA
CATCTGCATACGGCCATGTTTTCAAATCAAGGTGACTGACAAGTACATAATACCATGAAA
GTCTTGCTTCCTCAAACTGCTGCAGACCTAGTGCCAGAAAGACTTCAAAACACTCTGGCT
TTATTTTCATGGCCTCT

Last Updated on 07.07.2016 14:16