Sequences from confirmation amplicon


Confirmation sequences for line 111E10 and hit At1g64300 are shown.
Line ID 111E10
Locus At1g64300 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:23864901
Primers used for PCR PH12 - 8474, show primer details
   
Sequence Name 21-K017452-022-111-E10C-PH12
GenBank Accession LN495456 [GenBank]
Sequencing primer gene specific primer, PH12: 5'-GGGGATAGTTTTGTGTTGAGACAT-3'
Sequence (A. th genome BLAST matches underlined)
>21-K017452-022-111-E10C-PH12
TTTTCGGTGACTTGAGCCGTTGAATGCAGAGATTTCTTCTCTGTTATCGCTTTGTCATTC
GAATATACTTCAGTACCTTTGTGGATTCTATGATGAAGAAAGGAAAGAATGTTCTCTTGT
TATGGAGTTAATGCACAAAGATTTGAAAAGCTACATGAAGGAGAATTGTGGACCTAGAAG
AAGATATCTTTTCTCTGTTCCCGTTGTTATCGATATAATGCTTCAAATCGCGAGAGGGAT
GGAGTATCTTCATTCAAATGAGATTTTCCATGGAGATTTGAATCCAATGAACATTCTTTT
GAAAGAGAGAAGTCACACCGAAGGTTACTTCCACGCGAAAATCTCGGGTTTCGGTTTAAC
CTCAGTTAAGAATCAGTCTTTTTCTCGGGCTTCCTCTAGACCAACCACACCTGATCCTGT
AATATGGTATGCACCTGAAGTTCTAGCAGAGATGGAACAAGATCTCAAAGGTACAGCTCC
AAGATCAAAGTTTACACATAAAGCTGATGTCTATAGCTTTGCTATGGTGTGTTTTGAGCT
TATAACCGGTAAAGTTCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAATGAAAGACATTTTGA
TAAACGACAATTACGATCGTC
   
Sequence Name 22-K017452-022-111-E10C-8409
GenBank Accession LN495901 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K017452-022-111-E10C-8409
ATTTCCCGGAATGAAGCCCTTTACAATTGAATATATCCTGGAACTTTACCGGTTATAAGC
TCAAAACACACCATAGCAAAGCTATAGACATCAGCTTTATGTGTAAACTTTGATCTTGGA
GCTGTACCTTTGAGATCTTGTTCCATCTCTGCTAGAACTTCAGGTGCATACCATATTACA
GGATCAGGTGTGGTTGGTCTAGAGGAAGCCCGAGAAAAAGACTGATTCTTAACTGAGGTT
AAACCGAAACCCGAGATTTTCGCGTGGAAGTAACCTTCGGTGTGACTTCTCTCTTTCAAA
AGAATGTTCATTGGATTCAAATCTCCATGGAAAATCTCATTTGAATGAAGATACTCCATC
CCTCTCGCGATTTGAAGCATTATATCGATAACAACGGGAACAGAGAAAAGATATCTTCTT
CTAGGTCCACAATTCTCCTTCATGTAGCTTTTCAAATCTTTGTGCATTAACTCCATAACA
AGAGAACATTCTTTCCTTTCTTCATCATAGAATCCACAAAGGTACTGAAGTATATTCGAA
TGACAAAGCGATAACAGAGAAGAAATCTCTGCATTCAACGGCTCAAGATCACCGAAAAAA
T

Last Updated on 23.10.2014 13:25