Sequences from confirmation amplicon


Confirmation sequences for line 118H04 and hit At5g60630 are shown.
Line ID 118H04
Locus At5g60630 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24369984
Primers used for PCR DW01 - 8474, show primer details
   
Sequence Name 36-K021336-022-118-H04C-8409
GenBank Accession LN502053 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K021336-022-118-H04C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCCATTTACATGTAGAA
ACGGCGAGAGAACATTCGTCGATCCCGGTATGGTTACGCTTCCACTGAATTCTTCTGAAG
ATACTCGAAATTGCCATTCATTTCTCAAAAGGTTTGGTACATATTTGTTGGTTCGTTCTG
ATAATCTTCTAAAGATTTCTATCTCTAGTTTCCAGAGAATGTATATTTGTGATATAGTGT
ACGAACAAGATGCAAAAGTGAGTTATGTTTATTGAGAGATTCACAAATCACAACAATACA
ATTGTATTGAGAAACATAGAGAACATAAGTCATGACTCATGAGTATCTCTAATGGAAAAA
TGAAAACACATAAATATAACTTCATCTTTACATTCACTTCTCTTCCAATCTAGCCAGGAT
CGACTCTGCGAAACTCTGTTGCCTGTTTAGTTTAAAGAAAGCCAATTACCATCAACAGGC
ACAAGAATGTGAACTGTAAATACTTCGTATAGATTCAAGGATCAGAACAATTTCTGCAA
   
Sequence Name 37-K021336-022-118-H04C-DW01
GenBank Accession LN502458 [GenBank]
Sequencing primer gene specific primer, DW01: 5'-CATACTTGGAACTTGCAGAAATTG-3'
Sequence (A. th genome BLAST matches underlined)
>37-K021336-022-118-H04C-DW01
GATCCTTGAATCTATACGAAGTATTTACAGTTCACATTCTTGTGCCTGTTGATGGTAATT
GGCTTTCTTTAAACTAAACAGGCAACAGAGTTTCGCAGAGTCGATCCTGGCTAGATTGGA
AGAGAAGTGAATGTAAAGATGAAGTTATATTTATGTGTTTTCATTTTTCCATTAGAGATA
CTCATGAGTCATGACTTATGTTCTCTATGTTTCTCAATACAATTGTATTGTTGTGATTTG
TGAATCTCTCAATAAACATAACTCACTTTTGCATCTTGTTCGTACACTATATCACAAATA
TACATTCTCTGGAAACTAGAGATAGAAATCTTTAGAAGATTATCAGAACGAACCAACAAA
TATGTACCAAACCTTTTGAGAAATGAATGGCAATTTCGAGTATCTTCAGAAGAATTCAGT
GGAAGCGTAACCATACCGGGATCGACGAATGTTCTCTCGCCGTTTCTACATGTAAATGGC
AGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAAT
GTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACG
ATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATT

Last Updated on 07.07.2016 14:16