Sequences from confirmation amplicon


Confirmation sequences for line 122H03 and hit At2g39540 are shown.
Line ID 122H03
Locus At2g39540 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:16501533
Primers used for PCR PH13 - 8474, show primer details
   
Sequence Name 23-K017452-022-122-H03C-PH13
GenBank Accession LN496353 [GenBank]
Sequencing primer gene specific primer, PH13: 5'-AGCAAACTCTTTCGAGAAAACAAG-3'
Sequence (A. th genome BLAST matches underlined)
>23-K017452-022-122-H03C-PH13
GTGGTTGTACATTCTTCATACTCTCTCTTCTCCTCACATCTTCATTTTCTGTACTTTCAA
GTGCTGATTCGTGTAAGTGTTTACTTAATCTAGTTAATAATTGTAGGTCATGCATGTATC
ATTTTGAAACAAGTTTTCTGAAATTCTAAGATTTTACATATATATGTGATAAATGAATTA
GCAGCATGCGGTGGAAAGTGCAATGTGAGATGCTCAAAGGCAGGACAACATGAAGAATGC
CTCAAGTACTGCAATATATGTTGCCAGAAGTGTAATTGTGTTCCTTCGGGAACTTTTGGA
CACAAAGATGAATGTCCTTGCTACCGTGATATGAAAAACTCCAAAGGTGGATCCAAGTGT
CCTTGAACGTTCTTTGAAGATCCTCATCACATACATATAACTTCTACGTACTATATGTGT
GGAAATATTAATCACATTCTATGTTTGAAATATATAAAATAAAATCAATGCCCCCAATGT
TGGAAATCTTCAATGTGATATCTTAATATATATCACGAATAAAAAAGTTTAAATTTCTCA
ATCTCATTTTTAATCTTTAATCTAATTTCTTAACACATCAACGAATCTTTAATCTTTAAT
CATGTAGATAATTATCAGAGCACCTAAACATTGCGCCGTTTTGTGATTATACAAAGTAAC
ATCGTGCTGTTTTTGACTTTTGAAAACACAGATCCAAAACTACATGGATCAGNCATGAGT
ATG
   
Sequence Name 24-K017452-022-122-H03C-8409
GenBank Accession LN496795 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K017452-022-122-H03C-8409
CATGTAGTTTTTGGAATCTGTGGTTTCTCAAAGTCAAAAACAGCACGATGTTACTTTGTA
TAATCACAAAACGGCGCAATGTTTAGGTGCTCTGATAATTATCTACATGATTAAAGATTA
AAGATTCGTTGATGTGTTAAGAAATTAGATTAAAGATTAAAAATGAGATTGAGAAATTTA
AACTTTTTTATTCGTGATATATATTAAGATATCACATTGAAGATTTCCAACATTGGGGGC
ATTGATTTTATTTTATATATTTCAAACATAGAATGTGATTAATATTTCCACACATATAGT
ACGTAGAAGTTATATGTATGTGATGAGGATCTTCAAAGAACGTTCAAGGACACTTGGATC
CACCTTTGGAGTTTTTCATATCACGGTAGCAAGGACATTCATCTTTGTGTCCAAAAGTTC
CCGAAGGAACACAATTACACTTCTGGCAACATATATTGCAGTACTTGAGGCATTCTTCAT
GTTGTCCTGCCTTTGAGCATCTCACATTGCACTTTCCACCGCATGCTGCTAATTCATTTA
TCACATATATATGTAAAATCTTAGAATTTCAGAAAACTTGTTTCAAAATGATACATGCAT
GACCTACAATTATTAACTAGATTAAGTAAACACTTACACGAATCAGCACTTGAAAGTACA
GAAAATGAAGATGTGAGGAGAAGAGAGATTATGAAGAATTTGTAC

Last Updated on 07.07.2016 14:16