Sequences from confirmation amplicon


Confirmation sequences for line 125A07 and hit At1g16210 are shown.
Line ID 125A07
Locus At1g16210 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5547667
Primers used for PCR PE38 - 8474, show primer details
   
Sequence Name 54-K022410-022-125-A07C-8409
GenBank Accession LN508345 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>54-K022410-022-125-A07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATACAATCCCTTGTCCAAAGTTTAGA
GGGCCGCTTAACGGTTCAACCAACTTAATCCGAGAAAAGCCCAAGTTTTGATGGAGTTTG
GGAAATTTGAACTATTTTAAATTGGCAATAACCATAATTTAGTTTGCTTTGTAAAGTAAT
TGATCACACACTATAGACTTTTACTTCTCTTAGACATTAGGTTTTGATAGGAGGAGAATC
TAGTGTATTTTTTTTTTTTTCACAAAAAACAACGTATGTAACAATTATATACCCTTGAGG
CATATTCTTAGGAAAAGTTGGGACTTCGGAAATATTGATTTTTTACATGCAAGGTTAAAC
ATAAAACCTGAAAAATTTGGAGTCTTAAACTAATCCCTATAAAACATATATCCGGGGATT
GCCATTTGATTGAAACATCCGACCAGAGGCAAAAAACACGTTTCAGGTTCTATGTCAATT
ACGTGAACAATTCTGGCTAAAACTAAAGGTTTCAGTAAAATCAAATTTTTAAAATTTGAA
GGGGCAAAAAACATTTAAAGAGGGA
   
Sequence Name 55-K022410-022-125-A07C-PE38
GenBank Accession LN508676 [GenBank]
Sequencing primer gene specific primer, PE38: 5'-ACGTGAGCCACTTTATCACTCTTT-3'
Sequence (A. th genome BLAST matches underlined)
>55-K022410-022-125-A07C-PE38
CCCCCCCCCCAAAAAAAAACAAATCTTTTCTGCCCCTTCAAATTTTAAAAATCTGATTTT
ACTGAAACATTTAGTATTAGCAAGAATTGTTCACGTAATTGACATAGAACCTGAAACGTG
TCTCTTGCCTCTGGTCGGATGTTTCAATCAAATGACAATCACTGTATATATGTTTTATAG
TGATTAGTCTAAGACTCCAAATTTATCAGGTTCTATGTCTAACATTGCATGTAAAAAATC
AATATTTCCGAAGTCCAAACTCTTCCTAAGAATATGCATCAAGTGTATATAATTGTTACA
TACGTTGTTTCTTGTGAAAAAAAAAAAAATACCCTAAATTCCCCTCCTATCAAAACCTAA
TGTCTAAAAAAAGTAAAAGCCTATAGGGGGGGATCAATTACTTTACAAAGCAAACTAAAT
TATGGTTATTGCCAATTTAAAATAGTTCAAATTTCCCAAACTCCATCAAAACTTGGGCTT
TTCTCGGATTAAGTTGGTTGAACCGTTAAGCGGCCCTCTAAACTTTGGACAAGGGATTGT
ATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACTTGGATCACCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTCCCAATTTTTTTTCAATTCAAAAATG
Primers used for PCR FM86 - 8474, show primer details
   
Sequence Name 37-K032007-022-125-A07C-8409
GenBank Accession LN502507 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K032007-022-125-A07C-8409
TTACAATTGAATATATCCTTAACGACCTTAACAAATGAAATGATCGATCGGTTGTTGACC
CAGCTTTTGAGCCACCGCCTTAACCAAACAAAGCTGTTAAGATCGAACCAGTCAATTCTC
AGCTCTGAGCGGTACGGTTAATTCATTTCTTATCTATCACACAAAGTTGAATCGTAACCC
TAAGCGAATTCAACAATCGAGAGAGCGAGAGAGATCAATTAACCCCAGCGAATCGAATAT
GCCGAAGAAGATGGGTCTGAACAGCAAGGCGGAGGTCGCCAAATCTCGTAAGAACGCCGC
GGAGGCTGAGCAGAAGGATCGTCAGACTCGGGAGAAAGAGGAACAATACTGGCGCGAGGC
GGAAGGTCCCAAATCCAAAGCGGTGAAGAAGCGAGAAGAGGAAGCGGAGAAGAAGGCAGA
GACCGCCGCTAAGAAATTGGAGGCGAAGCGTCTGGCTGAGCAGGAGGAGAAAGAGTTGGA
GAAGGCTTTGAAAAAGCCAGACAAGAAGGCGAATCGCGTCACTGTGCCGGTTCCTAAGGT
CACAGAGGCTGAGCTCATCCGAAGACGCGAGGAAGATCAAGTGGCTCTGGCTAAGAAACG
NAAAGACTC
   
Sequence Name 38-K032007-022-125-A07C-FM86
GenBank Accession LN502879 [GenBank]
Sequencing primer gene specific primer, FM86: 5'-GAGTCTTCTGCTTTCTTAGCCAGA-3'
Sequence (A. th genome BLAST matches underlined)
>38-K032007-022-125-A07C-FM86
CCTCTGTGACCTTAGGAACCGGCACAGTGACGCGATTCGCCTTCTTGTCTGGCTTTTTCA
AAGCCTTCTCCAACTCTTTCTCCTCCTGCTCAGCCAGACGCTTCGCCTCCAATTTCTTAG
CGGCGGTCTCTGCCTTCTTCTCCGCTTCCTCTTCTCGCTTCTTCACCGCTTTGGATTTGG
GACCTTCCGCCTCGCGCCAGTATTGTTCCTCTTTCTCCCGAGTCTGACGATCCTTCTGCT
CAGCCTCCGCGGCGTTCTTACGAGATTTGGCGACCTCCGCCTTGCTGTTCAGACCCATCT
TCTTCGGCATATTCGATTCGCTGGGGTTAATTGATCTCTCTCGCTCTCTCGATTGTTGAA
TTCGCTTAGGGTTACGATTCAACTTTGTGTGATAGATAAGAAATGAATTAACCGTACCGC
TCAGAGCTGAGAATTGACTGGTTCGATCTTAACAGCTTTGTTTGGTTAAGGCGGTGGCTC
AAAAGCTGGGTCAACAACCGATCGATCATTTCATTTGTTAAGGTCGTTAAGGATATATTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACATT

Last Updated on 23.10.2014 13:25