Sequences from confirmation amplicon


Confirmation sequences for line 129B08 and hit At3g14440 are shown.
Line ID 129B08
Locus At3g14440 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4832657
Primers used for PCR KS14 - 8474, show primer details
   
Sequence Name 23-K024207-022-129-B08C-KS14
GenBank Accession LN496399 [GenBank]
Sequencing primer gene specific primer, KS14: 5'-GACACTCTTGAGATTCTCGTCAGA-3'
Sequence (A. th genome BLAST matches underlined)
>23-K024207-022-129-B08C-KS14
TCTGGTGGAGTCATACAGGACCCTATCACGACGACTTCATCTGTTTCTGGCTCTTCCCAA
GCGTTCCAGAGATGGAAGCAGAAGCAATCTGGAGCATCAATCCACTTAATGTTCGATGAA
TCTTCGGCGTATTTGTCTAAAATCCCGAATCTTGCGACCTTGTTCTTGTCGTAAACCACC
GGAGACCCACCGCGGATCATCTCCGGCAGCTTGAAAACGACTTGCTGGTCAGGTACGACG
ACGAAGTTCTCTGTAATCGCGAAATCGTGCATCATCGTTGGCTGATCAAGCTGAATCTCG
ACGTCCGGTGATTTAGTTCCGTCCGGTGAGAATCGGAAGTATTTTAGGTAAGGCTTTGAA
ACGACGTCGTAGCTTAAAGCGAAGAGTTCACCGGATTCCGGGTCGACTTTCGGGTGGGCA
ATCATTGTGGATTCTAATTGTCCATCAAAATCGAACCGACCAACGGTTTTTAAATCTCCA
TTGGTAATTACCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACC
AATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACAT
TTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTA
TTCTAATTCGGAAATCTTTATTTCGA
   
Sequence Name 24-K024207-022-129-B08C-8409
GenBank Accession LN496839 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K024207-022-129-B08C-8409
CCAATGGAGATTTAAAAACCGTTGGTCGGTTCGATTTTGATGGACAATTAGAATCCACAA
TGATTGCCCACCCGAAAGTCGACCCGGAATCCGGTGAACTCTTCGCTTTAAGCTACGACG
TCGTTTCAAAGCCTTACCTAAAATACTTCCGATTCTCACCGGACGGAACTAAATCACCGG
ACGTCGAGATTCAGCTTGATCAGCCAACGATGATGCACGATTTCGCGATTACAGAGAACT
TCGTCGTCGTACCTGACCAGCAAGTCGTTTTCAAGCTGCCGGAGATGATCCGCGGTGGGT
CTCCGGTGGTTTACGACAAGAACAAGGTCGCAAGATTCGGGATTTTAGACAAATACGCCG
AAGATTCATCGAACATTAAGTGGATTGATGCTCCAGATTGCTTCTGCTTCCATCTCTGGA
ACGCTTGGGAAGAGCCAGAAACAGATGAAGTCGTCGTGATAGGGTCCTGTATGACTCCAC
CAGACTCAATTTTCAACGAGTCTGACGAGAATCT

Last Updated on 07.07.2016 14:16