Sequences from confirmation amplicon


Confirmation sequences for line 152G06 and hit At4g38160 are shown.
Line ID 152G06
Locus At4g38160 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:17902296
Primers used for PCR DL04 - 8474, show primer details
   
Sequence Name 07-K016281-022-152-G06C-8409
GenBank Accession LN489037 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K016281-022-152-G06C-8409
GTACATTTCCCGGACATGAAGTTCAATTGGATAGCCGGAAAGGCTCTCCTCCAAGGTAAA
TTCCTCTCTACTTCCTTGTTAAAGCTCGAATCATCTCTAAGTTAAGCAAAATTGGTGTGT
TGTAGTGGCGTTTATATGGAGGTGACAAATACGAGCAGCATCATGTGGTTCTTCAGGGAC
AAAGGTTTCGATGATCCGAGTATCGACAAGATGTTGAGAAAATGCAAACAGTTGGAAAAG
GCTCAAAGCGATGTGGCATCAGAAAACTGGGACTACCTGAGTAACATTGTTGGTATCCAA
GAGAGAAAACTCCCTTACATCGTCTCTCGATGCCCCAAAATCCTGACTTTACGCCTCGAT
GAGAGACTCATCCCGATGGTCGAGTGCCTCTCCAGTCTTGGAAGGAATCCTCGGGAAGTT
GCTTCCGCCATTACCAAATTTCCTCCAATACTCTCTCAT
   
Sequence Name 08-K016281-022-152-G06C-DL04
GenBank Accession LN489502 [GenBank]
Sequencing primer gene specific primer, DL04: 5'-TCCTCCACGCTATGAGAGAGTATT-3'
Sequence (A. th genome BLAST matches underlined)
>08-K016281-022-152-G06C-dl04
GAAATTTGGTAATGGCGGAAGCAACTTCCCGAGGATTCCTTCCAAGACTGGAGAGGCACT
CGACCATCGGGATGAGTCTCTCATCGAGGCGTAAAGTCAGGATTTTGGGGCATCGAGAGA
CGATGTAAGGGAGTTTTCTCTCTTGGATACCAACAATGTTACTCAGGTAGTCCCAGTTTT
CTGATGCCACATCGCTTTGAGCCTTTTCCAACTGTTTGCATTTTCTCAACATCTTGTCGA
TACTCGGATCATCGAAACCTTTGTCCCTGAAGAACCACATGATGCTGCTCGTATTTGTCA
CCTCCATATAAACGCCACTACAACACACCAATTTTGCTTAACTTAGAGATGATTCGAGCT
TTAACAAGGAAGTAGAGAGGAATTTACCTTGGAGGAGAGCCTTTCCGGCTATCCAATTGA
ACTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAA
AAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATT
ATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGA
AAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25