Sequences from confirmation amplicon


Confirmation sequences for line 158B07 and hit At1g48310 are shown.
Line ID 158B07
Locus At1g48310 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:17853693
Primers used for PCR NB28 - 8474, show primer details
   
Sequence Name 77-K101271-0022-158-B07C-8409
GenBank Accession LN513517 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>77-K101271-0022-158-B07C-8409
GCCATTTACAATTGAATATATCCTGAAATGTAGAATCAACCAGCAACGCAATTCCTCTTC
TTCTTCTTCATTGCCAATTCCCAACGAGGTTTTTCCGCAATCCCTCTCTCTCTCTCTGGG
CGATTTTGTTGCGGTAGTTCGGGCGATTTCGGATGGCTTAGAGTGTTTGTAAATGGGCAA
TTTTGCTTCTAATAAGCCCTTATATGTGTGTGTTCTTATTCTCAGGTTCATACTTCGTCT
CAAGGAGCCAGAATCTTACCTTCAACTCTCGCCCCTAAACCGAACACTGGTCTGTTGATT
TTTCCAGTACCATTCATCTATGTATTTTTTGCTTACTCTTTGTTTTTTTGGGTTGTTCAC
GTTTACTGTATTAATTGTGAGTGCTAGTCTCTGTTCCAATAGATGCTGGCTCTAAGCCAC
AAGAGCAAAAGGTCTCTGTCAAAATTTTGCTTCATTCTAGTGGAGTTCTTGCTGCAAAGT
TCCCATATNACCAGGTAAGATAACAGAAGTCACAAGTCTTTGTGGGGAAATACTTGGT
   
Sequence Name 77-K101277-0022-158-B07C-NB28
GenBank Accession LN513518 [GenBank]
Sequencing primer gene specific primer, NB28: 5'-TACCAAGTATTTCCCCACAAAGAC-3'
Sequence (A. th genome BLAST matches underlined)
>77-K101277-0022-158-B07C-NB28
GGGAACTTTGCAGCAAGAACTCCACTAGAATGAAGCAAAATTTTGACAGAGACCTTTTGC
TCTTGTGGCTTAGAGCCAGCATCTATTGGAACAGAGACTAGCACTCACAATTAATACAGT
AAACGTGAACAACCCAAAAAAACAAAGAGTAAGCAAAAAATACATAGATGAATGGTACTG
GAAAAATCAACAGACCAGTGTTCGGTTTAGGGGCGAGAGTTGAAGGTAAGATTCTGGCTC
CTTGAGACGAAGTATGAACCTGAGAATAAGAACACACACATATAAGGGCTTATTAGAAGC
AAAATTGCCCATTTACAAACACTCTAAGCCATCCGAAATCGCCCGAACTACCGCAACAAA
ATCGCCCAGAGAGAGAGAGAGGGATTGCGGAAAAACCTCGTTGGGAATTGGCAATGAAGA
AGAAGAAGAGGAATTGCGTTGCTGGTTGATTCTACATTTCAGGATATATTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGC
Primers used for PCR AP32 - 8474, show primer details
   
Sequence Name 38-K118837-0022-158-B07C-AP32
GenBank Accession LN503163 [GenBank]
Sequencing primer gene specific primer, AP32: 5'-ATTAGGATGCTCAAGCTGGTTAAA-3'
Sequence (A. th genome BLAST matches underlined)
>38-K118837-0022-158-B07C-AP32
ATATTTGAATAAATCGATCATTGGATTTATGTAAACCACAATTGTTTCTTCAGAAAACCG
GTTAGTGGATTCCATAAACCGAATTATTTGAATCGACCCGAGTTAATAACCGGATTTGCC
CTGAAACTGGTGCATCTGTCGCCCTTGTCATCATCGAAAGTAAACCGCTCTGAAACGGTG
ACGTTTGGGAATGTAAACTTTGAAAAGGCGAAGACGGAGAGAGAGGGAAAGATCGATTTG
AGAAGAGAGATTCCTCCGCCATTGAAGAAGCTCACATCACATCATCCGAAAAAAGAAGAA
GAAGTGGAGGAGAGGGAATATCAAAATGGATGATTTCTGGGATTTGACTGTGGAAGAGAT
GGATTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTA
   
Sequence Name 14-K118836-0022-158-B07C-8409
GenBank Accession LN492735 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K118836-0022-158-B07C-8409
ATTGAAATCCATCTCTTCCACAGTCAAATCCCAGAAATCATCCATTTTGATATTCCCTCT
CCTCCACTTCTTCTTCTTTTTTCGGATGATGTGATGTGAGCTTCTTCAATGGCGGAGGAA
TCTCTCTTCTCAAATCGATCTTTCCCTCTCTCTCCGTCTTCGCCTTTTCAAAGTTTACAT
TCCCAAACGTCACCGTTTCAGAGCGGTTTACTTTCGATGATGACAAGGGCGACAGATGCA
CCAGTTTCAGGGCAAATCCGGTTATTAACTCGGGTCGATTCAAATAATTCGGTTTATGGA
ATCCACTAACCGGTTTTCTGAAGAAACAATTGTGGTTTACATTAAATCCAATGATCGATT
TTATTTTCAAATTGATTTTTCCGTACGATTTCGGCTTTAACCAGCTTGACAATCCTAA

Last Updated on 07.07.2016 14:16