Sequences from confirmation amplicon


Confirmation sequences for line 158E04 and hit At4g27010 are shown.
Line ID 158E04
Locus At4g27010 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13558420
Primers used for PCR LL01 - 8474, show primer details
   
Sequence Name 15-K021642-022-158-E04C-8409
GenBank Accession LN492774 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K021642-022-158-E04C-8409
CCATTTACAATTGAATATATCCTGTCCACTGTATATCTTCTCCACCAGTCCACACTGTTC
AAGAGAATTAAAAGCTACTCAAAGACAAAAACTTTCAAGGCAATTACAAATAAGTGATAC
AAGTCTTCATTCAAAGGTAAAGCCAGACAAATTTCAGCTAAAATTTTATTAATTGACTCA
AAAATTCCAACAATTAATTCCAAAAAATTCTAATGGTTAGTTTTTTTTTTGTTGGAAAAA
ACCAAACAGATATTGCTAAAAGAGTCTGCACATGTCAAGCTATTATCGTACCTTGATCTT
CCAAGTCTGATGATATTGATTCCGCCATCAAAAGAACACTACAGAGAACTCTTCTCTCTT
CGCGGGGTTTTAGTTTTAGGGTTTAACAGGACAAAACATATCGGCAACGCTGAGAGTTCG
AAATCAGGCATCTCAATCCCAAACCAATCCCGACCGGTTCGTATCGATTTTTTTGGTCAA
CCCTA
   
Sequence Name 16-K021642-022-158-E04C-LL01
GenBank Accession LN493244 [GenBank]
Sequencing primer gene specific primer, LL01: 5'-CCGGTTAAGTAAGTCTAGGGTTGA-3'
Sequence (A. th genome BLAST matches underlined)
>16-K021642-022-158-E04C-LL01
GGGATTGGTTTGGGATTGAGATGCCTGATTTCGAACTCTCAGCGTCGCCGATATGTTTTG
TCCTGTTAAACCCTAAAACTAAAACCCCGCGAAGAGAGAAGAGTTCTCTGTAGTGTTCTT
TTGATGGCGGAATCAATATCATCAGACTTGGAAGATCAAGGTACGATAATAGCTTGACAT
GTGCAGACTCTTTTAGCAATATCTGTTTGGTTTTTTCCAACAAAAAAAAAACTAACCATT
AGAATTTTTTGGAATTAATTGTTGGAATTTTTGAGTCAATTAATAAAATTTTAGCTGAAA
TTTGTCTGGCTTTACCTTTGAATGAAGACTTGTATCACTTATTTGTAATTGCCTTGAAAG
TTTTTGTCTTTGAGTAGCTTTTAATTCTCTTGAACAGTGTGGACTGGTGGAGAAGATATA
CATGGACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
AAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16