Sequences from confirmation amplicon


Confirmation sequences for line 160H04 and hit At5g24400 are shown.
Line ID 160H04
Locus At5g24400 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:8330526
Primers used for PCR MS30 - 8474, show primer details
   
Sequence Name 45-K016401-022-160-H04C-8409
GenBank Accession LN505358 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K016401-022-160-H04C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATTGCTGTTTTTAGA
GCTTGGAAGATGCTGGTTTGTCCAGGAACCAAACCAACTCGTCTTCAGCAGAAACAGAAC
CAGCAGGTGGTACATTCCCAGTCTTCTTTAAAGCTGCCTCCACAGCTTCAGCTTTCCCAG
AACCGCAAACAACTAGAGCTACATGTGCAGATGAGTTGATGACCGGGAACGTGAAGGTGA
TTCTCTCAGACGGTGGTTTTGGAGAGTCAGAGATTGAAACTACCCATTTCTTGCTCTCGT
TGCAGAGACCATGCCCAGGGAATAATGATGCCACATGACCATCAGGTCCCATACCTAGAA
GCATGAGATCAAATTTGGGAAAGCCAGTTGATTCAGATACACGGAGAATGTTGGTGTTGA
CCAAATGTTTGAGGCAGGTCTCGTAATCATCCGCTGCAGCCTCAGCGGAGAGGGCTTCGT
TGATTGCATATACATTTCCAGGCGGAATTGGTACCTAAAGAGAAATGATTAGACTGTGAA
GAAGTTGTAGCTGACTCTTAACCTGAAGAGAACGTGTTCAATACCTTGGATAGAAAACTA
TCATAAGCGAGTTTATAGTTGCTATCATCGTGATTCTTGGGAA
   
Sequence Name 49-K016401-022-160-H04C-MS30
GenBank Accession LN506664 [GenBank]
Sequencing primer gene specific primer, MS30: 5'-GAGAGAGTTGTTCCCAAGAATCAC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K016401-022-160-H04C-ms30
AGCAACTATAAACTCGCTTATGATAGTTTTCTATCCAAGGTATTGAACACGTTCTCTTCA
GGTTAAGAGTCAGCTACAACTTCTTCACAGTCTAATCATTTCTCTTTAGGTACCAATTCC
GCCTGGAAATGTATATGCAATCAACGAAGCCCTCTCCGCTGAGGCTGCAGCGGATGATTA
CGAGACCTGCCTCAAACATTTGGTCAACACCAACATTCTCCGTGTATCTGAATCAACTGG
CTTTCCCAAATTTGATCTCATGCTTCTAGGTATGGGACCTGATGGTCATGTGGCATCATT
ATTCCCTGGGCATGGTCTCTGCAACGAGAGCAAGAAATGGGTAGTTTCAATCTCTGACTC
TCCAAAACCACCGTCTGAGAGAATCACCTTCACGTTCCCGGTCATCAACTCATCTGCACA
TGTAGCTCTAGTTGTTTGCGGTTCTGGGAAAGCTGAAGCTGTGGAGGCAGCTTTAAAGAA
GACTGGGAATGTACCACCTGCTGGTTCTGTTTCTGCTGAAGACGAGTTGGTTTGGTTCCT
GGACAAACCAGCATCTTCCAAGCTCTAAAAACAGCAATCAGGATATATTCAATTGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTAT
TATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCG
AAAGCAATAAACAAATTATTCTAAT

Last Updated on 23.10.2014 13:25