Sequences from confirmation amplicon


Confirmation sequences for line 165D04 and hit At4g14920 are shown.
Line ID 165D04
Locus At4g14920 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:8534319
Primers used for PCR AY06 - 8474, show primer details
   
Sequence Name 22-K015117-022-165-D04C-AY06
GenBank Accession LN495887 [GenBank]
Sequencing primer gene specific primer, AY06: 5'-AGCAAACTAAATCACCTCCATCTC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K015117-022-165-D04C-AY06
AAATACCACAAGCATCGTCATTTGGATCATCAGCAATTACATCTACTGAACAAAAACCAA
TGTTCCCAGCACCCTTTTGCTTATCCCATGCATCTATTTGGCATTGAAGAAGAGAAACCC
CAGAATTCAAAAATATGTTCTGAAATGGCTGCCGCAATTTGCTTCCAGCATGTATCTCAA
ACTTCGAAACCGCAAGAATTTTACTACAGCAACCACAGTGAATCCCGTCTCTTGTTATCC
AACCCTCAAGCATGGCGCGTGTCCGGCGTTGGTTCATGTACATTACCTTTTCACTCAACT
GTAAGGTTCCACTATCAATCAGCCATGCCAGTACCGTCCGTTTTTCAGATGAGGGTACAA
AACCATCACTCTCTGAATTATCTCCTCTGACTGAACGCCGCACCAACAGTGTACTCCTAC
CATGTTTGCTACTTTTCCCTCCATCCACACGGTGAGAGGAGGAACCAGTTGACTTTTCAG
TTTGGTGATGCAAAGGGCTTTCACTTTTTGAAGTTGTACCCTGTGAACTATCTCTGCTGT
TGACCTCAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACATTCACGTCCAAATGGGGG
   
Sequence Name 21-K015117-022-165-D04C-8409
GenBank Accession LN495445 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K015117-022-165-D04C-8409
TAGATTTCCCGGACATGAAGCCATTGAGGTCAACAGCAGAGATAGTTCACAGGGTACAAC
TTCAAAAAGTGAAAGCCCTTTGCATCACCAAACTGAAAAGTCAACTGGTTCCTCCTCTCA
CCGTGTGGATGGAGGGAAAAGTAGCAAACATGGTAGGAGTACACTGTTGGTGCGGCGTTC
AGTCAGAGGAGATAATTCAGAGAGTGATGGTTTTGTACCCTCATCTGAAAAACGGACGGT
ACTGGCATGGCTGATTGATAGTGGAACCTTACAGTTGAGTGAAAAGGTAATGTACATGAA
CCAACGCCGGACACGCGCCATGCTTGAGGGTTGGATAACAAGAGACGGGATTCACTGTGG
TTGCTGTAGTAAAATTCTTGCGGTTTCGAAGTTTGAGATACATGCTGGAAGCAAATTGCG
GCAGCCATTTCAGAACATATTTTTGAATTCTGGGGTTTCTCTTCTTCAATGCCAAATAGA
TGCATGGGATAAGCAAAAGGGTGCTGGGAACATTGGTTTTTGTTCAGTAGATGTAATTGC
TGATGATCCAAATGACGATGCTTGTGGTATTTGTG

Last Updated on 07.07.2016 14:16