Sequences from confirmation amplicon


Confirmation sequences for line 168A02 and hit At2g18570 are shown.
Line ID 168A02
Locus At2g18570 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8063382
Primers used for PCR ZZ95 - 8474, show primer details
   
Sequence Name 11-K023493-022-168-A02C-8409
GenBank Accession LN490930 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K023493-022-168-A02C-8409
CCGGACATGAAGCCATTTATACAGAAACTAGCAACTAAAAAGAAAAGTAAGTGGTCGACC
ATCGATCATGGACCAGCCTCACGCGCTTCTAGTGGCTAGCCCTGGCTTGGGTCACCTCAT
CCCTATCCTGGAGCTCGGCAACCGTCTCTCCTCCGTCCTAAACATCCACGTCACCATTCT
CGCGGTCACCTCCGGCTCCTCTTCACCGACAGAAACCGAAGCCATACATGCAGCCGCGGC
TAGAACAATCTGTCAAATTACGGAAATTCCCTCGGTGGATGTAGACAACCTCGTGGAGCC
AGATGCTACAATTTTCACTAAGATGGTGGTGAAGATGCGAGCCATGAAGCCCGCGGTACG
AGATGCCGTGAAATTAATGAAACGAAAACCAACGGTCATGATTGTTGACTTTTTGGGTAC
GGAACTGATGTCCGTAGCCGATGACGTAGGCATGACGGCTAAATACGTTTACGTTCCAAC
TCATGCGTGGTTCTTGGCAGTCATGGTGTACTTGCCGGTGTTAGAT
   
Sequence Name 12-K023493-022-168-A02C-ZZ95
GenBank Accession LN491390 [GenBank]
Sequencing primer gene specific primer, ZZ95: 5'-CCTTCCACTACCGTATCTAACACC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K023493-022-168-A02C-ZZ95
CACCATGACTGCCAAGAACCACGCATGAGTTGGAACGTAAACGTATTTAGCCGTCATGCC
TACGTCATCGGCTACGGACATCAGTTCCGTACCCAAAAAGTCAACAATCATGACCGTTGG
TTTTCGTTTCATTAATTTCACGGCATCTCGTACCGCGGGCTTCATGGCTCGCATCTTCAC
CACCATCTTAGTGAAAATTGTAGCATCTGGCTCCACGAGGTTGTCTACATCCACCGAGGG
AATTTCCGTAATTTGACAGATTGTTCTAGCCGCGGCTGCATGTATGGCTTCGGTTTCTGT
CGGTGAAGAGGAGCCGGAGGTGACCGCGAGAATGGTGACGTGGATGTTTAGGACGGAGGA
GAGACGGTTGCCGAGCTCCAGGATAGGGATGAGGTGACCCAAGCCAGGGCTAGCCACTAG
AAGCGCGTGAGGCTGGTCCATGATCGATGGTCGACCACTTACTTTTCTTTTTAGTTGCTA
GTTTCTGTATAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAT
GTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGT
CGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATNTCGACG
TGTCTAC

Last Updated on 07.07.2016 14:16