Sequences from confirmation amplicon


Confirmation sequences for line 171H05 and hit At3g20220 are shown.
Line ID 171H05
Locus At3g20220 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7055322
Primers used for PCR EP24 - 8474, show primer details
   
Sequence Name 05-K102173-0022-171-H05C-8409
GenBank Accession LN488299 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K102173-0022-171-H05C-8409
TTTACAATTGAATATATCCTGAAGCCATTTACATGTAATTACTCTTTTTCTCCATGTACT
TTCTCCAAACTCGTCCGCTACTTCATCCATCAAACTCCTAAATTCAGGATATTGAAGATA
CTTGGTCGGTATCACAAACCTTTGCCTCTCTTCGCGCCCCACATAGACCGCAAGATGTCC
TCTCGGGACACCGTTTTGATCTCTGGCTGGTCTGCTACCGTCCGATAACTCCCCCGAGAC
AAGACGATCCTTAATGTTAGTTTCGTACCTTCTGTTTCGTCTGTTCTCCTGGTTTGCTAG
ACGCACGATGAAACTTAGCGAAATCATTTTTGTTGAATAGAAAGAAAGATATCAAAAAAA
TCAAGCGGAATGGTGTCTTGAGAAAAGTTCAAAAGGAATCATTTATATATCTATCAATGT
CAAAAGACTTTGCATTTGATAGATCATAGATAACAACGATAAAGATCTTATGATGAAAGT
TGTTATCTTCATAGAACTTTAAATAAAAAACAAGCTAGGTTAATCAAACCCTAGTTGTTC
TTGTTTCTTATTTTTCCTTGTTTGATTTAAATGATCTGTCTGCCTTTTATATGTCTATTG
TTTTCGTGGTCAACAA
   
Sequence Name 05-K102177-0022-171-H05C-EP24
GenBank Accession LN488300 [GenBank]
Sequencing primer gene specific primer, EP24: 5'-CTTGTTGACCACGAAAACAATAGA-3'
Sequence (A. th genome BLAST matches underlined)
>05-K102177-0022-171-H05C-EP24
TTAATCAACAAGGAAAAATAAGAAACAAGAACAACTAGGGGTTTGATTAACCCCTTTTGT
TTTTTATTTAAAGTTCTATGAAGATAACAACTTTCATCATAAGATCTTTATCGTTGTTAT
CTATGATCTATCAAATGCAAAGTCTTTTGACATTGATAGATATATAAATGATTCCTTTTG
AACTTTTCTCAAGACACCATTCCGCTTGATTTTTTTGATATCTTTCTTTCTATTCAACAA
AAATGATTTCGCTAAGTTTCATCGTGCGTCTAGCAAACCAGGAGAACAGACGAAACAGAA
GGTACGAAACTAACATTAAGGATCGTCTTGTCTCGGGGGAGTTATCGGACGGTAGCAGAC
CAGCCAGAGATCAAAACGGTGTCCCGAGAGGACATCTTGCGGTCTATGTGGGGCGCGAAG
AGAGGCAAAGGTTTGTGATACCGACCAAGTATCTTCAATATCCTGAATTTAGGAGTTTGA
TGGATGAAGTAGCGGACGAGTTTGGAGAAAGTACATGGAGAAAAAGAGTAATTACATGTA
AATGGCTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAAAATGTAGATGTCCGCAGCGTT
Primers used for PCR EP25 - 8474, show primer details
   
Sequence Name 06-K102173-0022-171-H05C-Oril
GenBank Accession LN488751 [GenBank]
Sequencing primer gene specific primer, Oril: unknown
Sequence (A. th genome BLAST matches underlined)
>06-K102173-0022-171-H05C-Oril
ATTTCAGCCATATCAGTGTTTACACTGATAGTTTAAACCGAACGCGGGAAACGACAATCT
GATCCCCGGGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTC
TTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATC
CACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGG
GGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATC
GCAATGATGGTCAATTGAATACTTTCCTGGACGATCATGAAGGAGGGATTCATATTCCTT
GTGAAGAAAGTGTTTTTGAAGAGATTTTGATTAGATACATGTCTTGTGACAAGAAGAAAT
AAGTGTACATACAATACAAATATATATAAGCATTTTTAAAATATTTCTACTCCTTCGTAT
TCTTTCTCCCCATTGGCATTTCATGGAACACCTAGTAAGCAACTCTGTCTTCTTGAACCA
TTCTCTACCAACGATTTCTCCTCTGCTCTGCATAGGTATCAAAACAAGATACAGAGCTTC
TTGGTAATGAAAATGCTAAGTCATTTATTCTAAGAGAGAATGAATCAAGGAACAAAAATA
ATGCCATGTTCCTTAATAGTATCGATTACAATCCCTAGCTTCCCTTCAATTCTTTCTCCC
TTTCTTGGCTCATAAGAGACAGCATAGACGTCTGCTTCCATTGAACGCTCAGCTATGAGC
TTACCGATGAGTCTACACGCTTCGTTATCAACAAGAGACGGTATATTAGTCCTTATATCT
CTAGCATTTGTGGTGGCAACTGAAATGACTTTGCTTGTTGGCCTATGCATCACTTTAGCG
TGTATGAATTTCCTG
   
Sequence Name 06-K102177-0022-171-H05C-EP25
GenBank Accession LN488752 [GenBank]
Sequencing primer gene specific primer, EP25: 5'-CCTTTCCTTCTGAATGTGTTCTTC-3'
Sequence (A. th genome BLAST matches underlined)
>06-K102177-0022-171-H05C-EP25
TAGGCCACAAGCAAAGTCATTTCAGTTGCCACCACAAATGCTCGAGATATAAGGACTAAT
ATACCGTCTCTTGTTGATAACGAAGCGTGTAGACTCATCGGTAAGCTCATAGCTGAGCGT
TCAATGGAAGCAGACGTCTATGCTGTCTCTTATGAGCCAAGAAAGGGAGAAAGAATTGAA
GGGAAGCTAGGGATTGTAATCGATACTATTAAGGAACATGGCATTATTTTTGTTCCTTGA
TTCATTCTCTCTTAGAATAAATGACTTAGCATTTTCATTACCAAGAAGCTCTGTATCTTG
TTTTGATACCTATGCAGAGCAGAGGAGAAATCGTTGGTAGAGAATGGTTCAAGAAGACAG
AGTTGCTTACTAGGTGTTCCATGAAATGCCAATGGGGAGAAAGAATACGAAGGAGTAGAA
ATATTTTAAAAATGCTTATATATATTTGTATTGTATGTACACTTATTTCTTCTTGTCACA
AGACATGTATCTAATCAAAATCTCTTCAAAAACACTTTCTTCACAAGGAATATGAATCCC
TCCTTCATGATCGTCCAGGAAAGTATTCAATTGACCATCATTGCGATAAAGGAAAGGCCA
TCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCA
TCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCT
CCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAT
AAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCG
CCT

Last Updated on 07.07.2016 14:16