Sequences from confirmation amplicon


Confirmation sequences for line 172F08 and hit At2g32950 are shown.
Line ID 172F08
Locus At2g32950 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13977969
Primers used for PCR MR39 - 8474, show primer details
   
Sequence Name 19-K016285-022-172-F08C-MR39
GenBank Accession LN494543 [GenBank]
Sequencing primer gene specific primer, MR39: 5'-CGTCATATAATAAGCTGCATTCCA-3'
Sequence (A. th genome BLAST matches underlined)
>19-K016285-022-172-F08C-mr39
GATAAATACTTTCAATACACTATCATTCCTATAAACATGCTTCTATTTAGCTGTAATAAG
CAGAATCCTACCACAATACTACACATCAAAAACAAAACAAAACCTTCCTAAGAAAATCTA
ATGGCAAGGTTCATTGGAATCGATTAAAGACTAAGCTAGCTTACTTGTTTCCACAAAAAC
CACGACAAAAACCAAACTTGATTACAAGCTAAGACTCAAACAAGCAACACCCGAACTTGA
ACTGAAAAGCTAAGGACCAAACACAAATTACGAGTAAAATTAGAAAAAGAAACCTTATCG
AGCAAGAAATTAGGGTAAAGCTGATTATTGGTGAGGTGTTGGCTACAACAGGGACAATCA
CTCTTGTTCCTAAGATGTGTGATGATACACATATAGCAGAAACTATGACCACAAGCCGTG
AGGAAAGCATCTTTAATAATCTGCATACAAATCGGACAAAGCAAGTCTTTATCCAGATCC
GGTGCTCCAATCTCAGAACCGCCGCTTCCTCCGTCGTCATTTTCATGACGATTAGCACCT
TCACCAACTGAAGATGTTCTCGGGTCAGGTTTCACCGCTGGAACAACCGGATCCGTCGAA
ATCTCTTCCATTTTGCTTTCAAAAGATTTCTTCGATTGTGATATATAGATTCAATTGATA
TATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAT
GGTCAATATGGA

Last Updated on 07.07.2016 14:16