Sequences from confirmation amplicon


Confirmation sequences for line 173G02 and hit At1g03220 are shown.
Line ID 173G02
Locus At1g03220 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:788604
Primers used for PCR MP38 - 8474, show primer details
   
Sequence Name 31-K023833-022-173-G02C-8409
GenBank Accession LN499991 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K023833-022-173-G02C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCGGGAAATATTATCGCA
TAAAATTATTAAATAAAATTGTAATGATTTATCAAATAAAATTCACTCGTTACATAATTT
ATTCAAATCAGTTGATAACAAATGCCAAATAATGATTCCATTGGCTCTTTATTAATCACA
TCAAACATAATATAATAACCACTAAAAAACAGTTTTAAAAAAAGAAAACGGATCAACTAA
TTTAATCAAGCAGTGGAAGTGAAATTGAAGTTGGCGCAGTTAGTTTGACGGCCCAATAAC
GTGGAACTAAACCCAAATTTGTTACTCGCCAAATCAAATTCGATCAAATTATCCTCCAAC
TGAAACCCTCCAATCACAACAGAGGTTCTTGCGTTGACTCCTCCGTCAACGAAACCCAAA
CAGATGACGTCATCACTGACACTCACCATCGAGTTGGCTCCAAATATCCTCCAAACGACG
TCTTTGCTATGAAGCACAAGCTCAATCTCCGGCACGGCGTATCCTAGGCGCGTCACGCCG
ACGTTCTTCGTGCTGAAACACGCGCCGAACGGTTTCACCGACGCTACTCTCTTGATGCTC
CTCGCCGCTGCTTGTTTAACGAACTCCGACGTANAAGCATTGTAGATCGATGACTCCAAC
ACCGTGTAAGGATTGACGGAGCTGATTTTGGTTCCTCCGATACCGGTACTTGCGTTAATC
TTCA
   
Sequence Name 33-K023833-022-173-G02C-MP38
GenBank Accession LN500833 [GenBank]
Sequencing primer gene specific primer, MP38: 5'-TCAATCCAACGCTATTGAAGATTA-3'
Sequence (A. th genome BLAST matches underlined)
>33-K023833-022-173-G02C-MP38
TACCGGTATCGGAGGAACCAAAATCAGCTCCGTCAATCCTTACACGGTGTTGGAGTCATC
GATCTACAATGCTTTTACGTCGGAGTTCGTTAAACAAGCAGCGGCGAGGAGCATCAAGAG
AGTAGCGTCGGTGAAACCGTTCGGCGCGTGTTTCAGCACGAAGAACGTCGGCGTGACGCG
CCTAGGATACGCCGTGCCGGAGATTGAGCTTGTGCTTCATAGCAAAGACGTCGTTTGGAG
GATATTTGGAGCCAACTCGATGGTGAGTGTCAGTGATGACGTCATCTGTTTGGGTTTCGT
TGACGGAGGAGTCAACGCAAGAACCTCTGTTGTGATTGGAGGGTTTCAGTTGGAGGATAA
TTTGATCGAATTTGATTTGGCGAGTAACAAATTTGGGTTTAGTTCCACGTTATTGGGCCG
TCAAACTAACTGCGCCAACTTCAATTTCACTTCCACTGCTTGATTAAATTAGTTGATCCG
TTTTCTTTTTTTAAAACTGTTTTTTAGTGGTTATTATATTATGTTTGATGTGATTAATAA
AGAGCCAATGGAATCATTATTTGGCATTTGTTATCAACTGATTTGAATAAATTATGTAAC
GAGTGAATTTTATTTGATAAATCATTACAATTTTATTTAATAATTTTATGCGATAATATT
TCCCGCAGGATATATTNCATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGN
CATGAGTATGAT

Last Updated on 07.07.2016 14:16