Sequences from confirmation amplicon


Confirmation sequences for line 187H03 and hit At1g60810 are shown.
Line ID 187H03
Locus At1g60810 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22388807
Primers used for PCR IW24 - 8474, show primer details
   
Sequence Name 05-K016198-022-187-H03C-8409
GenBank Accession LN488138 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K016198-022-187-H03C-8409
TACATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCTTAATCAGTTTCTA
ACTGTTTTTACATGTCTGTTTGATTTCAAGGTGTATGGTCCTGAAGCAACAATGACAGGT
ATATGCAAGGAGGCAATCCAGTACATCACAGCGGCTGCATAAGCCTTTACAATCTTATCA
CTTACTTTCAAAATACTCTTTAGCGTCTCTTGAGTTTGAGACGTGTTTGGATTATGTTTC
ACTTCTAATGTATCTTACTATTCATAAATAAAGAACAAGTATCTTCTTTTTTCTTACTTG
GTATTTTCTCTTTTGATTCTCATCTTCTTCTTGACTTAGATCAGAAGAAAACGTATTTAA
TCAACTTTTATCTAGCAACTCCAAAAATTCTACTAGGAAATAACGATATGGAATCAGAAG
CATTTAAGCCTTTTACACACGATGCAAGCAATTTGCTGAAGTGGATATCGACAGTCATAG
ACATGTCCATTTTTAGACTTGGCTATTCAAAAATTTGGACCATTTTTCTATTAATCAGGG
CCCGTTTTTAGTGATAGCTCTGGATATTTTCATTGAGCTGGGCCTTTTCTGGTCATGGAA
AGAGATTGCAATATCTATTT
   
Sequence Name 06-K016198-022-187-H03C-IW24
GenBank Accession LN488580 [GenBank]
Sequencing primer gene specific primer, IW24: 5'-CCACTTGGGATGGCTAAATAGATA-3'
Sequence (A. th genome BLAST matches underlined)
>06-K016198-022-187-H03C-iw24
CAATCTCTTTCATGACCAGAAAAGGCCCAGCTCAATGAAAATATCCAGAGCTATCACTAA
AAACGGGCCCTGATTAATAGAAAAATGGTCCAAATTTTTGAATAGCCAAGTCTAAAAATG
GACATGTCTATGACTGTCGATATCCACTTCAGCAAATTGCTTGCATCGTGTGTAAAAGGC
TTAAATGCTTCTGATTCCATATCGTTATTTCCTAGTAGAATTTTTGGAGTTGCTAGATAA
AAGTTGATTAAATACGTTTTCTTCTGATCTAAGTCAAGAAGAAGATGAGAATCAAAAGAG
AAAATACCAAGTAAGAAAAAAGAAGATACTTGTTCTTTATTTATGAATAGTAAGATACAT
TAGAAGTGAAACATAATCCAAACACGTCTCAAACTCAAGAGACGCTAAAGAGTATTTTGA
AAGTAAGTGATAAGATTGTAAAGGCTTATGCAGCCGCTGTGATGTACTGGATTGCCTCCT
TGCATATACCTGTCATTGTTGCTTCAGGACCATACACCTTGAAATCAAACAGACATGTAA
AAACAGTTAGAAACTGATTAAGACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATC

Last Updated on 23.10.2014 13:25