Sequences from confirmation amplicon


Confirmation sequences for line 190G11 and hit At1g06490 are shown.
Line ID 190G11
Locus At1g06490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:1986135
Primers used for PCR VL35 - 8474, show primer details
   
Sequence Name 61-K022563-022-190-G11C-8409
GenBank Accession LN510405 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>61-K022563-022-190-G11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATGACCCAGATATAGTTACCA
GTAAGGAAGGAAGTGGGCTACGAATGTATGAACTTAATTATTATAAATTTCCTTTGCATA
CCTCATCCAATTTGTCACATCCTTTGAGTAGCACAGAGTAGAATACTTTCTGTGATTTTC
CATTAACTGTCTCCTCCCTTTCATCTATATAGGCAACACGCAATGACGGATACCTAACCA
TAATGTATAATTAAAACTAAGCTAGAAGAATAAGCATATGAAGTTTTGATTTCAAACAAG
AGAACTTTCTTACTTTAGCATGAGCTGTAAAATGTTATTGTAACAACTCCGGTCTCGGCT
TTCACTTGACTTTTTCTGGTTCCCATAGACCTGACAGGACACGACATATGTAAATTTTAA
ATCTGCAAGAGCTCGTGCACGGTCACTAAAAGCCTTTCGATCATCTTCATTTGATTCTGA
GGGAAGATAGCCACCATTGGTAGCTGCAAGAAGAAAATAGAGTTCATAAAACAATCTTCT
TCACAAGCAAGATTAACTTTGACAACTAAATGAAGTAGTGGAGGATACTTAGGCA
   
Sequence Name 62-K022563-022-190-G11C-VL35
GenBank Accession LN510645 [GenBank]
Sequencing primer gene specific primer, VL35: 5'-ACCTTACAGATATTGTGGTTTGGC-3'
Sequence (A. th genome BLAST matches underlined)
>62-K022563-022-190-G11C-VL35
TTCTCTGCCTAAGTATCCTCCACTACTTCATTTAGTTGTCAAAGTTAATCTTGCTTGTGA
AGAAGATTGTTTTATGAACTCTATTTTCTTCTTGCAGCTACCAATGGTGGCTATCTTCCC
TCAGAATCAAATGAAGATGATCGAAAGGCTTTTAGTGACCGTGCACGAGCTCTTGCAGAT
TTAAAATTTACATATGTCGTGTCCTGTCAGGTCTATGGGAACCAGAAAAAGTCAAGTGAA
AGCCGAGACCGGAGTTGTTACAATAACATTTTACAGCTCATGCTAAAGTAAGAAAGTTCT
CTTGTTTGAAATCAAAACTTCATATGCTTATTCTTCTAGCTTAGTTTTAATTATACATTA
TGGTTAGGTATCCGTCATTGCGTGTTGCCTATATAGATGAAAGGGAGGAGACAGTTAATG
GAAAATCACAGAAAGTATTCTACTCTGTGCTACTCAAAGGATGTGACAAATTGGATGAGG
TATGCAAAGGAAATTTATAATAATTAAGTTCATACATTCGTAGCCCACTTCCTTCCTTAC
TGGTAACTATATCTGGGTCATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGA

Last Updated on 23.10.2014 13:25