Sequences from confirmation amplicon


Confirmation sequences for line 191F12 and hit At2g30360 are shown.
Line ID 191F12
Locus At2g30360 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:12937079
Primers used for PCR JK04 - 8474, show primer details
   
Sequence Name 21-K027576-022-191-F12C-8409
GenBank Accession LN495522 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K027576-022-191-F12C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAATGGCTAAAATCTACA
TGGAGATACTCATTCAAATATCATAATGTCAAATGCCATTATCATAATTGATGAGGATCC
AATTTTATACTCATTGATCAAAAAGCACAAAATAGATACCTACAATTTGGTACAGTATTT
AAATACATACATTAATTTTTATTATTTTTTCTCTGTTTTTAATTCCGAAACAAAAGTAGT
AGAAACCAAATCCAACCAACGAAACGCGATTGGCGTTTTAAAATTGAAAGCACGGTAGAA
AACTTCATAGCGTTCTTTTAAATAGCCGCGTTTGTTGACGACGTCTGATCGCAAACGCGA
ATAAGTTGAACCCTGAGTTTACCATTCCACATCTCCTTATAACAATCACCATCACCACCT
CTCCGCCGTGCCTCCACCACCACAAGCAAATCATTCAACCGCGAAATACAAATCCCGATA
CCAAATTTCCCATTTTGCCCCTCCATCTCAAACCCATACTCTTCCTCCTTCTTCTTCTTC
ATCCTCAGATTCTCCTCTCTCGCAAACCCCTCCACTTCCTCCGCCAACATCTCCGGCGAC
TTTTCCGATAAAAACCTCTCCGATTCACCACTCGAATTACTACAACCAGCAAACAATCCC
GACAAATCCAATCCCGACGAGTAAGAAATCAAATCAAACGCGTTTAAACTCTTCACAGCT
TCTAG
   
Sequence Name 25-K027576-022-191-F12C-JK04
GenBank Accession LN497296 [GenBank]
Sequencing primer gene specific primer, JK04: 5'-AGATCAGAAAGTGGAATCGTCACT-3'
Sequence (A. th genome BLAST matches underlined)
>25-K027576-022-191-F12C-JK4
AGTTTAAACGCGTTTGATTTGATTTCTTACTCGTCGGGATTGGATTTGTCGGGATTGTTT
GCTGGTTGTAGTAATTCGAGTGGTGAATCGGAGAGGTTTTTATCGGAAAAGTCGCCGGAG
ATGTTGGCGGAGGAAGTGGAGGGGTTTGCGAGAGAGGAGAATCTGAGGATGAAGAAGAAG
AAGGAGGAAGAGTATGGGTTTGAGATGGAGGGGCAAAATGGGAAATTTGGTATCGGGATT
TGTATTTCGCGGTTGAATGATTTGCTTGTGGTGGTGGAGGCACGGCGGAGAGGTGGTGAT
GGTGATTGTTATAAGGAGATGTGGAATGGTAAACTCAGGGTTCAACTTATTCGCGTTTGC
GATCAGACGTCGTCAACAAACGCGGCTATTTAAAAGAACGCTATGAAGTTTTCTACCGTG
CTTTCAATTTTAAAACGCCAATCGCGTTTCGTTGGTTGGATTTGGTTTCTACTACTTTTG
TTTCGGAATTAAAAACAGAGAAAAAATAATAAAAATTAATGTATGTATTTAAATACTGTA
CCAAATTGTAGGTATCTATTTTGTGCTTTTTGATCAATGAGTATAAAATTGGATCCTCAT
CAATTATGATAATGGCATTTGACATTATGATATTTGAATGAGTATCTCCATGTAGATTTT
AG

Last Updated on 23.10.2014 13:25