Sequences from confirmation amplicon


Confirmation sequences for line 198F06 and hit At2g22330 are shown.
Line ID 198F06
Locus At2g22330 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:9490380
Primers used for PCR 08xp - 8474, show primer details
   
Sequence Name 13-K119323-0022-198-F06C-08xp
GenBank Accession LN492275 [GenBank]
Sequencing primer gene specific primer, 08xp: 5'-CAATCATATAGGGCCGTGGTAATA-3'
Sequence (A. th genome BLAST matches underlined)
>13-K119323-0022-198-F06C-08xp
TTATTAATCATCAAAACAAAACCAAAATTAATACTTACTTATGGAAAAAAGCAAGAGAAA
ACACAAATCAGGGGTTTTCCAAAAGGACCAAAACCGAACAAAGTTGGGTTTGGGATTCAC
AAAACTTGGGGTTATCCATAGTATATACGGAATTATCCTCGCCGTACGTCACCGTCGCCT
CATTTCACCATGGGGAAAAGGTCCTCCAACAATCTCAATTCTCCAACCAACACCAAAGGC
TTCAAAAGAAACATATCAGGACTCGATTCCATAAGCTCGACACGTGTCTCATTTCCGGCT
AGTTTCCACTTAAACCCTTGCAAAAGCCTCGCTAGCATCAGGGTCGTTATCGCCGTACCT
AACGCCGGAGCAGCACATCCTCTCTTTCCGGTACTAAACGAGATAAAACGGAAATCATTC
TCCGTCAAAGTCACTTCCAAACACTCATTGAAATGCCTTTCTGGTTTGAAGCTAAGTGGA
TCAAACCAAACCTTGGGGTTACAACCAAAACCGTAACGGCAAATTAAAACTTGACTTCCT
TTAGGAATATGGTAACCTGCAACGGTCGTATCAAAAAGTGCCACGTGTGGAAGGTTAAAG
GCGGCAACGGAATAAAAACGGAAACCTTCTCGAATAAAAGCTTTAACATAGTTAAGTTTT
GGTATATCGAATTCTTGGACAAATCTTTCTTTTCCGACAACTCTATCGATCTCTTCCATA
GCTTTGTGGAGGATCTCCGGTTTGTTTATCAATTGTAAATGGCTTCATGTCCGGGAAATC
TACTTGGATCAGCAATGAGTATGATGGTCAATAT
   
Sequence Name 01-K119322-0022-198-F06C-8409
GenBank Accession LN486803 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K119322-0022-198-F06C-8409
AGCCATTTACAATTGATAAACAACCGGAGATCCTCCACAAAGCTATGGAAGAGATCGATA
GAGTCGTCGGAAAAGAAAGATTCGTCCAAGAATCCGATATACCAAAACTTAACTATGTTA
AAGCTATTATCCGAGAAGCTTTCCGTCTTCATCCCGTCGCCGCCTTCAACCTCCCACACG
TGGCACTCTCTGATACGACCGTCGCAGGTTACCATATTCCTAAAGGAAGTCAAGTTTTAC
TTAGCCGTTACGGTCTTGGTCGTAACCCCAAGGTTTGGTCTGATCCACTTAGCTTCAAAC
CAGAAAGGCATCTCAATGAGTGTTCGGAAGTGACTTTGACGGAGAATGATCTCCGTTTTA
TCTCGTTTAGTACCGGAAAGAGAGGATGTGCTGCTCCGGCGTTAGGTACGGCGATAACGA
CCATGATGCTAGCGAGGCTTTTGCAAGGGTTTAAGTGGAAACTAGCAGGAAGTGAGACAC
GTGTCGAGCTTATGGAATCGAGTCATGATATGTTTCTTTCGAAGCCTTTGGTGTTGGTCG
GAGAATTGAGATTGTCGGAGGACCTTTACCCAATGGTGAAGTGAGGCGACGGTGACGTAC
GGCGAGGATAATTCCGTATATACTATGGATAACCCAAAGTTTAGTGAATCACAAACCAAA
CTTTGTTCGGTTTTGGTCCTTTTGGAAACACTTGATCTGTGTTTTCTCTTGCTTTTTTCT
ATATGTATGTATTAATTTTGGTTTTGTTTTGATGATTAATAAGAAGGTATTCACATCGAG
TATCTCTTGACAATTGTCTTTTTTTTTTTCTCGTCAAGGATGGGGTCGCGACAAAATACT
ACA
Primers used for PCR 34xq - 8474, show primer details
   
Sequence Name 14-K119323-0022-198-F06C-34xq
GenBank Accession LN492739 [GenBank]
Sequencing primer gene specific primer, 34xq: 5'-TTTCATCTCTATCAAGGACGAAGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K119323-0022-198-F06C-34xq
ATCAACCACCATTAAGGTACATAGCTTTTTAATATACTTTTCATATGTTACATTTATACA
TATTTAAAAAATTAAACCAACTGTTACGTTCGATATATAATAATATATGACATAGTATTT
ATATATAGTATCGACGAGTAAATAGTTTGACATTCTTTGAGTTGAAATAGTGGAGATTTC
TAATATTCTTTAGAAAAATATGCGTTGAAAGAGTAATATTTCACTTTTGGCAGAGAAAAT
GCCATAACATCTATTACAAAGTATCTTTGCTAAAAAAAACAAGGCAATCCACCAATATCC
GTCAGATTCAGACGTATTTTTTGTTTAATATAAGAAAGTTAAATATGGTGAAAGCGAAAC
ATAACGTCAAATATCCATGTTGACTCGTGAGTCATGAGTCCACTCATGGAAAAAGGGTTT
GGCTTTTTTGGAGTTAAAATGGCAGAAACTTATTAGGAAGGAAATAGTGGAGACACAACA
TCTATAAAATAAAAGAAAAAAAAAAACTGATTGTGACTCTTTTTTGCTGTCCACAAATTA
AAAGAACAAAAACAATTGTCTTAGCAATTTTGGGAGAAAAGGTTAAACACCAAACAATCT
ATATCCAACAAAATCTTATGTGTAGCATAAAGCATGTTGACCACGAGTCCATGCATAGAA
CAGTAAACCGATAAGAATCTTTATCTTTTTGGTTATAAGATAAGAATCATTTATTAATTG
TCAACTTGCTTAAACTAATGAAAATATTTTACATATTAATTTTATAGGAACTTGTAATGG
CGGCGCCAGACAACCCATTACATGAATATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAGAGTAATTACCATTTTTT
   
Sequence Name 02-K119322-0022-198-F06C-oriL
GenBank Accession LN487259 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K119322-0022-198-F06C-oriL
TGGGTTGTCTGGCGCCGCCATTACAAGTTCCTATAAAATTAATATGTAAAATATTTTCAT
TAGTTTAAGCAAGTTGACAATTAATAAATGATTCTTATCTTATAACCAAAAAGATAAAGA
TTCTTATCGGTTTACTGTTCTATGCATGGACTCGTGGTCAACATGCTTTATGCTACACAT
AAGATTTTGTTGGATATAGATTGTTTGGTGTTTAACCTTTTCTCCCAAAATTGCTAAGAC
AATTGTTTTTGTTCTTTTAATTTGTGGACAGCAAAATAGAGTCACAATCAGTTTTTTTTT
TTCTTTTATTTTAAAGATGTTGGGTCTCCACTATTTCCTTCCTAATAAGTTTCTGCCATT
TTAACTCCAAAAAAGCCAAACCCTTTTTCCATGAGTGGACTCATGACTCACGAGTCAACA
TGGATATTTGACGTTATGTTTCGCTTTCACCATATTTAACTTTCTTATATTAAACAAAAA
ATACGTCTGAATCTGACGGATATTGGTGGATTGCCTTGTTTTTTTTAGCAAAAATACTTT
GTAATAAATGTTATGGCATTTTCTCTGCCAAAAGTGAAATATTACTCTTTCAACGCAAAT
TTTTCTAAAAAATATTAAAAATCTCCACTATTTCAACTCAAAGAATGTCAAACTATTTAC
TCGTCGATACTATATATAAATACTATGTCATATATTATTATATATCGAACGTAACAGTTG
GTTTAATTTTTTAAATATGTATAAATGTAACATATGAAAAGTATATTAAAAAGCTATGTA
CCTTAATGGTTGGTTTGATTTCATCAGCGGTAAGCAAAGGCTGGCC

Last Updated on 07.07.2016 14:16