Sequences from confirmation amplicon


Confirmation sequences for line 208G05 and hit At5g24520 are shown.
Line ID 208G05
Locus At5g24520 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:8372780
Primers used for PCR ZZ85 - 8474, show primer details
   
Sequence Name 23-K023370w-022-208-G05C-ZZ85
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, ZZ85: 5'-GAGAGAGAGCAACAATACGAGACA-3'
Sequence (A. th genome BLAST matches underlined)
>23-K023370w-022-208-G05C-ZZ85
GCACCATTACCGCCGGCGCAACTGCTTCCAAATATTGACAAACAAATTTGAATCTGGATC
TTCTCTATTCGTGAACAAGGAGATAGAAGCTACGATGAATGCATGGAAGCTTGGTTTGCT
TTAATATAAACACTAAAGGGGAGTAGAACTTTCTTGAAAAATTGTATGCAAATTATTTAC
CGAATGTTAAAAGCTTTTTTCGAATAAATTTTACATTTTCTTAATAATAATAATAAAAAA
GGATTGTTGATTATCTTAATCACAAACAATTTATTTTAGCTGAATTAGACAATTGTTAGT
AAAATGATTAGAGTGTCACATATTAATGTTGTTAGTGTTTCATGTCATCCTAGTGATCCA
ATAATTAGGCCATTCTATAGCTCTTAACGTTAAAATAAAAGGCCCATTATCTGAATATAC
AGAAGCCCATTATCAATAGATACATTAAAAGATACTGATTAATCCAGAGGGTTTATATCT
ACGCCGTCTCCATTGATTATTTCTCCGTCTCTTGAAAAATCCGACTGACACTGACCTCAA
AACTCTCCTCTCACTTTCGACTGACATTGATTATATGTTCAGGATATATTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG
   
Sequence Name 19-K023370w-022-208-G05C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K023370w-022-208-G05C-8409
GATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAACATATAATCAATGTCA
GTCGAAAGTGAGAGGAGAGTTTTGAGGTCAGTGTCAGTCGGATTTTTCAAGAGACGGAGA
AATAATCAATGGAGACGGCGTAGATATAAACCCTCTGGATTAATCAGTATCTTTTAATGT
ATCTATTGATAATGGGCTTCTGTATATTCAGATAATGGGCCTTTTATTTTAACGTTAAGA
GCTATAGAATGGCCTAATTATTGGATCACTAGGATGACATGAAACACTAACAACATTAAT
ATGTGACACTCTAATCATTTTACTAACAATTGTCTAATTCAGCTAAAATAAATTGTTTGT
GATTAAGATAATCAACAATCCTTTTTTATTATTATTATTAAGAAAATGTAAAATTTATTC
GAAAAAAGCTTTTAACATTCGGTAAATAATTTGCATACAATTTTTCAAGAAAGTTCTACT
CCCCTTTAGTGTTTATATTAAAGCAAACCAAGCTTCCATGCATTCATCGTAGCTTCTATC
TCCTTGTTCACGAATAGAGAAGATCCAGATTCAAATTTGTTTGTCAATATTTGGAAGCAG
TTGCGCCGGCGGTAATGGTGCCTCTCCATGTCTCGTATG

Last Updated on 07.07.2016 14:16