Sequences from confirmation amplicon


Confirmation sequences for line 212D10 and hit At5g44380 are shown.
Line ID 212D10
Locus At5g44380 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:17880841
Primers used for PCR EP14 - 8474, show primer details
   
Sequence Name 24-K102174-0022-212-D10C-8409
GenBank Accession LN496938 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K102174-0022-212-D10C-8409
GCTTCTTTAATTTGTATGAAAATTTATATAAACAATCATATTTGTGATATATTTAATACT
TTCTAGGCCATCATATATATATAAAATTATTTATTTCTAGATATTAACAAAAATATCATA
TTAATATACATACTGTATATACTTAATAACTAACTAAAACTATTTATCAAACATAAATTT
CTAGTTATCTATATATAGGTACTTAATTACTAATTTATTTATATCAAATAAGAAATGAGT
TAAGCCGAAACTTATACACGTCCATGAGTCCTCAATGGTTTAGACTTAAGAGTCTAGCAT
GCAAGACCGGCCCATGATTTAAGCAGGGTAAATCGGTAACCAACGCTTAGTTAGGACCCA
AAAT
   
Sequence Name 24-K102178-0022-212-D10C-EP14
GenBank Accession LN496939 [GenBank]
Sequencing primer gene specific primer, EP14: 5'-AATTTTGGGTCCTAACTAAGCGTT-3'
Sequence (A. th genome BLAST matches underlined)
>24-K102178-0022-212-D10C-EP14
GGCCGGTCTGCATGCTAGACTCTTAAGTCTAACCATTGAGGACTCATGGACGTGTATAAG
TTTCGGCTTAACTCATTTCTTATTTGATATAAATAAATTAGTAATTAAGTACCTATATAT
AGATAACTAGAAATTTATGTTTGATAAATAGTTTTAGTTAGTTATTAAGTATATACAGTA
TGTATATTAATATGATATTTTTGTTAATATCTAGAAATAAATAATTTTATATATATATGA
TGGCCTAGAAAGTATTAAATATATCACAAATATGATTGTTTATATAAATTTTTCATACAA
ATATAAAGAACGGCAATATAGCCATTTTAATTGAATTACGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTAT

Last Updated on 23.10.2014 13:25