Sequences from confirmation amplicon


Confirmation sequences for line 213A10 and hit At3g29670 are shown.
Line ID 213A10
Locus At3g29670 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:11527661
Primers used for PCR ZZ87 - 8474, show primer details
   
Sequence Name 14-K023359-022-213-A10C-8409
GenBank Accession LN492323 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K023359-022-213-A10C-8409
GTAGATTTCCCGGACATGAAGCCTATTTTGGTCGTAAAGTAGGGAAGATTCAAAAATTCA
CGACTCATTACTATATACTATTAACTTTCCTTTAGAAGAAATAACACCGTATCTCTCCAA
TATTTTAAACTATAGTTAGAATATAGCTTGTTAATATTTTGTACAGCGCATAGAGATTTC
CTTATTGATTCTGTTGTCTAGTCTATATATATCGTTGAAAGGTGTATCTCGAGAAACACA
ACCATCTTACTCTACATTTCCCATTTTTGAGACTCCTAAATCATTTTAACCTTCTTCCTC
AATCGTGACCATCACCAATGACGCTACACGTCATTGAGACTGCCCGAGTCACCCCCACCG
ACTACTCAGTCATCAACTCAGCCAACTTGCACAAACTTCCTTTAACTTTCTTCGACCTTC
CATGGCTACTATTCCAGCCAGTCAAAAGAGTCTTCTTCTACGAGCTCACCGAGTCTACTC
GTGACCATTTCCACTCCATTATCCTCCCTAAGCTCAAGGACTCTCTGTCCCTTATCCTCC
GTAACTATCTCCCTCTCACTGGCCACATCACTTGGGAGCCAAACGAGCCAAAACCGAGCA
TAATCGTCTCGGAAAACGGCGTCGTTTTGGTGA
   
Sequence Name 15-K023359-022-213-A10C-ZZ87
GenBank Accession LN492784 [GenBank]
Sequencing primer gene specific primer, ZZ87: 5'-ACTCTCGGCTATAGTCACCAAAAC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K023359-022-213-A10C-ZZ87
CGCCGTTTTCGAGACGATTATGCTCGGTTTTGGCTCGTTTGGCTCCCAAGTGATGTGGCC
AGTGAGAGGGAGATAGTTACGGAGGATAAGGGACAGAGAGTCCTTGAGCTTAGGGAGGAT
AATGGAGTGGAAATGGTCACGAGTAGACTCGGTGAGCTCGTAGAAGAAGACTCTTTTGAC
TGGCTGGAATAGTAGCCATGGAAGGTCGAAGAAAGTTAAAGGAAGTTTGTGCAAGTTGGC
TGAGTTGATGACTGAGTAGTCGGTGGGGGTGACTCGGGCAGTCTCAATGACGTGTAGCGT
CATTGGTGATGGTCACGATTGAGGAAGAAGGTTAAAATGATTTAGGAGTCTCAAAAATGG
GAAATGTAGAGTAAGATGGTTGTGTTTCTCGAGATACACCTTTCAACGATATATATAGAC
TAGACAACAGAATCAATAAGGAAATCTCTATGCGCTGTACAAAATATTAACAAGCTATAT
TCTAACTATAGTTTAAAATATTGGAGAGATACGGTGTTATTTCTTCTAAAGGAAAGTTAA
TAGTATATAGTAATGAGTCGTGAATTTTATGAATCTTCCCTACTTTACGACCAAAATAGG
CTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGGAGAAA
AAGAAAGAGTAATTACCAATTTTTTTTCATTCAAAAATGTAGATGTCCGCAGCGTTATTA
TAAAATGAAAGTACATTTTGATAAAACGACAAATT

Last Updated on 23.10.2014 13:25