Sequences from confirmation amplicon


Confirmation sequences for line 221A06 and hit At3g56240 are shown.
Line ID 221A06
Locus At3g56240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20864104
Primers used for PCR MR67 - 8474, show primer details
   
Sequence Name 61-K017282-022-221-A06C-MR67
GenBank Accession LN510390 [GenBank]
Sequencing primer gene specific primer, MR67: 5'-AGGCTCAACATTACCTTTCACTGT-3'
Sequence (A. th genome BLAST matches underlined)
>61-K017282-022-221-A06C-MR67
ATGTCAAATGACTCAACCCCTGAGATTATATAATAAATTATAGAGTCAATAAATTATAAG
GCTTAAAATAAAGGGAAACAATGATTAGTAGAAAGTATTTGAAAGACATGAAAAAAAGAT
TAGAGAGAAATACCTTCCATTTTGCCTAAAACTCTATTGACGGCACCAACGCAGCCTTGG
CATGACATACCAACTTTGAGGACAACGGTCTGCATTAATTAGACAATTTAATCCGAAAAT
GTAAGAACCATATCCATATACATAGGACCAATTCGGTCCAAATATATCAACAGCTAATTT
TATCACAATTATTAACTGTTATCTTTTGTGCTCTAGCTTAATAATATTTACCTTTTTTGA
TGAATATTTCAAAGTGGTGCTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
TTATTTCGACGTGTCTACATT
   
Sequence Name 62-K017282-022-221-A06C-8409
GenBank Accession LN510640 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>62-K017282-022-221-A06C-8409
ATAGATTTCTCCGACATGAAGCCATTTAGCACCACTTTGAAATATTCATCAAAAAAGGTA
AATATTATTAAGCTAGAGCACAAAAGATAACAGTTAATAATTGTGATAAAATTAGCTGTT
GATATATTTGGACCGAATTGGTCCTATGTATATGGATATGGTTCTTACATTTTCGGATTA
AATTGTCTAATTAATGCAGACCGTTGTCCTCAAAGTTGGTATGTCATGCCAAGGCTGCGT
TGGTGCCGTCAATAGAGTTTTAGGCAAAATGGAAGGTATTTCTCTCTAATCTTTTTTTCA
TGTCTTTCAAATACTTTCTACTAATCATTGTTTCCCTTTATTTTAAGCCTTATAATTTAT
TGACTCTATAATTTATTATATAATCTCAGGGGTTGAGTCATTTGACATTGATATCAAGGA
GCAAAAGGTGACAGTGAAAGGTAATGTTGAGCC

Last Updated on 07.07.2016 14:16