Sequences from confirmation amplicon


Confirmation sequences for line 227B07 and hit At4g39400 are shown.
Line ID 227B07
Locus At4g39400 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:18326494
Primers used for PCR MR26 - 8474, show primer details
   
Sequence Name 31-K017465-022-227-B07C-MR26
GenBank Accession LN499948 [GenBank]
Sequencing primer gene specific primer, MR26: 5'-CCGTAAGCATAGTAAGAGCTGACA-3'
Sequence (A. th genome BLAST matches underlined)
>31-K017465-022-227-B07C-mr26
TCCCATCGAGCNTTATCGTCTTGAAAGATCAAGAATGTTTAAACCTCTTAGATCACCTAC
CTCATCAGGAATCGAACCAGAGATATCGTTATGACCCAAATTGAGAATAAACAGATAAGG
CATCGAACCAATCTCCTTCGGTATGTATCCAGACAACATGTTGTAAGACATGTCCAGAAA
CATCATCGAACCATTGTTATCAAACGTCGGCGAAGTGTGACCTCCATAGACTCTGCTAGT
GATATTACAAGGGTTCCTCGTTGAAAGCCGGTTTAATTGTTCGGATCTGATTCCTTGAAA
CTCAAGTAAATTACCAGCTCCATGACACTCTTTCTTCATCCCATCGTTTTTGATATAAAC
GTACCTCTTACCGGCGATGAAATTGGCAGCGATTTTCCCGGATTGTTTAAACATCGCCGC
CGGAATCGTTCCATTGAAGAGATTGGTGTTGAGATCAAGCCAGATTAAGCTTCTGCAGTC
GCCAATAATTACCAATTATTCAATATGGCTTCATGTCCGGGAAATCTACATGGATCAGCA
ATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTC
AAAAATGTAGATGTCCGCAGCGTTATTATAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAAAATAACAATTATTCTAATTCGGAAATCT
TTATTTCGA
   
Sequence Name 32-K017465-022-227-B07C-8409
GenBank Accession LN500375 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K017465-022-227-B07C-8409
CATGTAGATTTCCCGGAATGAAGCCTATTGAATAATTGGTAATTATTGGCGACTGCAGAA
GCTTAATCTGGCTTGATCTCAACACCAATCTCTTCAATGGAACGATTCCGGCGGCGATGT
TTAAACAATCCGGGAAAATCGCTGCCAATTTCATCGCCGGTAAGAGGTACGTTTATATCA
AAAACGATGGGATGAAGAAAGAGTGTCATGGAGCTGGTAATTTACTTGAGTTTCAAGGAA
TCAGATCCGAACAATTAAACCGGCTTTCAACGAGGAACCCTTGTAATATCACTAGCAGAG
TCTATGGAGGTCACACTTCGCCGACGTTTGATAACAATGGTTCGATGATGTTTCTGGACA
TGTCTTACAACATGTTGTCTGGATACATACCGAAGGAGATTGGTTCGATGCCTTATCTGT
TTATTCTCAATTTGGGTCATAACGATATCTCTGGTTCGATTCCTGATGAGGTAGGTGATC
TAAGAGGTTTAAACATTCTTGATCTTTCAAGCAATAAGCTCGATGGGAGGATTCCTCAGG
CTATGTCAGCTCTTCCTTATGCTTA

Last Updated on 07.07.2016 14:16