Sequences from confirmation amplicon


Confirmation sequences for line 228B12 and hit At1g18570 are shown.
Line ID 228B12
Locus At1g18570 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6390212
Primers used for PCR RS05 - 8474, show primer details
   
Sequence Name 46-K016602-022-228-B12C-8409
GenBank Accession LN505707 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K016602-022-228-B12C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGTCTAAGATAATTGGCCCATCTCA
GTCTGCAGCTTTTGCCGCATCTCTTGAGTCCTATCCAATTAGAAGAATTATTTAAGTAAA
ATAATTGAGCAATAATGACCAATAAAGGTCCAACATTGAATATTCAAACATGACGGAATA
AACATAATAAAAAATAATACATACCAGCTTTTTCGGGGAGAGTTCGCCATCCACCTTCAC
CGTGGCGGTTAAGGTAAGAGAGAAGCTTCTGATCTTCCTCGGGAGTCCAAGCTCCTTTCT
TTAACCCTAGTTCAGCTTTGCAACACGGTGTCCGCACCATTCTTGATTCTTCAAACTTAG
CTTTCTTGATCGAGTTCAAAGGGGGTTGTTCTCAAGTGAAACAAAGAGGGACAAAA
   
Sequence Name 50-K016602-022-228-B12C-RS05
GenBank Accession LN507014 [GenBank]
Sequencing primer gene specific primer, RS05: 5'-TTTTTGTCCCTCTTTGTTTCACTT-3'
Sequence (A. th genome BLAST matches underlined)
>50-K016602-022-228-B12C-rs05
AACCCCCTTTGAACTCGATCAAGAAAGCTAAGTTTGAAGAATCAAGAATGGTGCGGACAC
CGTGTTGCAAAGCTGAACTAGGGTTAAAGAAAGGAGCTTGGACTCCCGAGGAAGATCAGA
AGCTTCTCTCTTACCTTAACCGCCACGGTGAAGGTGGATGGCGAACTCTCCCCGAAAAAG
CTGGTATGTATTATTTTTTATTATGTTTATTCCGTCATGTTTGAATATTCAATGTTGGAC
CTTTATTGGTCATTATTGCTCAATTATTTTACTTAAATAATTCTTCTAATTGGATAGGAC
TCAAGAGATGCGGCAAAAGCTGCAGACTGAGATGGGCCAATTATCTTAGACAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
Primers used for PCR 47xd - 3144, show primer details
   
Sequence Name 09-K118952-0022-228-B12C-35St
GenBank Accession LN490418 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K118952-0022-228-B12C-35St
TCTTATATGTGGTTTTATCAGATGGTCTGCTATAGCTCGTGGACTACCAGGAAGAACCGA
TAACGAGATCAAGAACTACTGGAACACTCATATCAAAAAACGTTTGATCAAGAAAGGTAT
TGATCCAGTTACACACAAGGGCATAACCTCCGGTACCGACAAATCAGAAAACCTCCCGGA
GAAACAAAATGTTAATCTGACAACTAGTGACCATGATCTTGATAATGACAAGGCGAAGAA
GAACAACAAGAATTTTGGATTATCATCGGCTAGTTTCTTGAACAAAGTAGCTAATAGGTT
CGGAAAGAGAATCAATCAGAGTGTTCTGTCTGAGATTATCGGAAGTGGAGGCCCACTTGC
TTCTACTAGTCACACTACTAATACTACAACTACAAGTGTTTCCGTTGACTCTGAATCAGT
TAAGTCAACGAGTTCTTCCTTCGCACCAACCTCGAATCTTCTCTGCCATGGGACCGTTGC
AACAACACCAGTTTCATCGAACTTTGACGTTGATGGTAACGTTAATCTGACGTGTTCTTC
GTCCACGTTCTCTGATTCCTCCGTTAACAATCCTCTAATGTACTGCGATAATTTCGTTGG
TAATAACAACGTTGATGATGAGGATACTATCGGGTTCTCCACATTTCTGAATGATGAAGA
TTTCATGATGTTGGAGGAGTCTTGTGTTGAAAACACTGCGTTCATGAAAGAACTTACGAG
GTTTCTTCACGAGGATGAAAACGACGTCGTTGATGTGACGCCGGTCTATGAACGTCAAGA
CTTGTTTGACGAAATTTGATACTATTTTGGATGAGTGAAACTCATAATCGATGAATCCCA
CGTGACCATGTCAATATGATGTCTATGGATATGTTACCTTGATG

Last Updated on 23.10.2014 13:25