Sequences from confirmation amplicon


Confirmation sequences for line 233H02 and hit At1g13030 are shown.
Line ID 233H02
Locus At1g13030 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:4445783
Primers used for PCR SW01 - 8474, show primer details
   
Sequence Name 09-K026133-022-233-H02C-8409
GenBank Accession LN490022 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K026133-022-233-H02C-8409
TTCCCGGCACATGAAGCCATGTAAATTGGTAATTTTTAAAATGATTTTCAAGAGTTTCAC
AGTGCTTTTCCTTGGTTGCTTGAATATATACAACCAACTGCGTCTGTAGAAGCTGCAAAT
CATGTAACAATAAAGAAGATATAAGTGTTGAAGCGCAGGCTGTACATCACTAAAACACGT
GATGCATACATAAATCTTATCATTTTAAGTTTAAAGTATTTGATGAAGAACCTCTTCCTT
CTCTAGTTTTGTTTTCTCTCTCAGCCATTGCCGTTTCGCCTTTTTACGTCGGGCACTTCT
GCTAGGTGTCTAAAATAAAAATAAGGAAGAGTGAAGGACTGATAGGAAGCTAAATGAGTA
AGTGAAACAAAAGCCAATCCCTGCATCTACAAACATCAAGGAATTTTACACTCTACACAT
ATTGTTCATTCTAATTCCTTGCAACAACTAAGTAAACTCAAACCTTTTTAGTTTCAGCAG
ATAGTTGGCACAGATCGTTATGCTCTT
   
Sequence Name 10-K026133-022-233-H02C-SW01
GenBank Accession LN490495 [GenBank]
Sequencing primer gene specific primer, SW01: 5'-AAGAAGAGAGCAAAGAGCATAACG-3'
Sequence (A. th genome BLAST matches underlined)
>10-K026133-022-233-H02C-SW01
CTGTGCCAACTATCTGCTGAAACTAAAAAGGTTTGAGTTTACTTAGTTGTTGCAAGGAAT
TAGAATGAACAATATGTGTAGAGTGTAAAATTCCTTGATGTTTGTAGATGCAGGGATTGG
CTTTTGTTTCACTTACTCATTTAGCTTCCTATCAGTCCTTCACTCTTCCTTATTTTTATT
TTAGACACCTAGCAGAAGTGCCCGACGTAAAAAGGCGAAACGGCAATGGCTGAGAGAGAA
AACAAAACTAGAGAAGGAAGAGGTTCTTCATCAAATACTTTAAACTTAAAATGATAAGAT
TTATGTATGCATCACGTGTTTTAGTGATGTACAGCCTGCGCTTCAACACTTATATCTTCT
TTATTGTTACATGATTTGCAGCTTCTACAGACGCAGTTGGTTGTATATATTCAAGCAACC
AAGGAAAAGCACTGTGAAACTCTTGAAAATCATTTTAAAAATTACCAATTTACATGGCTT
CATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGA
AAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCT

Last Updated on 07.07.2016 14:16