Sequences from confirmation amplicon


Confirmation sequences for line 235B06 and hit At5g21170 are shown.
Line ID 235B06
Locus At5g21170 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:7206092
Primers used for PCR CK63 - 8474, show primer details
   
Sequence Name 26-K023359-022-235-B06C-8409
GenBank Accession LN497741 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023359-022-235-B06C-8409
CATGTTCACTTGACTTTTCATTGCTGATCCATGTAGATTTCCCGGACACTTTCTTCATTT
AGATAGGATCCAAGTACAAAATCTCCAGCCTTTTTTTTATGAGTGAACTCTACTTGTTCA
CTTGATTTGTGTTATCCTGTTGGTTCTTGAGAATTTGTAATGTAGATTCTTGTTCTTAAA
GCTTTTTTCTGAGTTGGGTTTAGAGATTCTGTACTAGAGAATCTCTTTTATTTTTGTGTT
ATCTTGGTTCAGGTATCTTGAAATAATGCATAATGTGGAAAAGTTTCTACCTTTCTTTAA
GATGTTGTTTTGGTTTCCTAGCTATTTTTTCTTTATTTTCCAGCCGGTCTCTAGTCATTT
ACTGGTCGCTC
   
Sequence Name 27-K023359-022-235-B06C-CK63
GenBank Accession LN498203 [GenBank]
Sequencing primer gene specific primer, CK63: 5'-TGAGCGACCAGTAAATGACTAGAG-3'
Sequence (A. th genome BLAST matches underlined)
>27-K023359-022-235-B06C-CK63
GGAAAATAAAGAAAAAATAGCTAGGAAACCAAAACAACATCTTAAAGAAAGGTAGAAACT
TTTCCACATTATGCATTATTTCAAGATACCTGAACCAAGATAACACAAAAATAAAAGAGA
TTCTCTAGTACAGAATCTCTAAACCCAACTCAGAAAAAAGCTTTAAGAACAAGAATCTAC
ATTACAAATTCTCAAGAACCAACAGGATAACACAAATCAAGTGAACAAGTAGAGTTCACT
CATAAAAAAAAGGCTGGAGATTTTGTACTTGGATCCTATCTAAATGAAGAAAGTGTCCGG
GAAATCTACATGGATCAGCAATGAAAAGTCAAGTGAACATGGATCAGCAATGAGTATGAT
GGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGA
TGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCG
TCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGAC
GTGTCTACATTC

Last Updated on 23.10.2014 13:25