Sequences from confirmation amplicon


Confirmation sequences for line 239B09 and hit At1g01720 are shown.
Line ID 239B09
Locus At1g01720 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:269330
Primers used for PCR MZ12 - 8474, show primer details
   
Sequence Name 25-K017400-022-239-B09C-MZ12
GenBank Accession LN497227 [GenBank]
Sequencing primer gene specific primer, MZ12: 5'-TTAAATTGATTGCGGCACATATAA-3'
Sequence (A. th genome BLAST matches underlined)
>25-K017400-022-239-B09C-mz12
GGATTTTCTTCTACCTAACACAGTAATACACTACTGATACATCCAACGACCACCGTCCGA
TTAGGGATGATCTGAAATCGGACGGTCTATAGAATAAACGAAGACTGAACAGAAATCTAA
TGGCCGAATCGGCACACTCATTGACCATATAAAACGGTCTCGTGTTGCCATAAACGCAAA
AACGAGGGTCGTTTTGCGTTGCGTTTCGGCGGCAGGAAAGGAATTCCCTTCTAGTAAGGC
TTCTGCATGTACATGAACATATCCTGTAGCGGAAACATCTGATTACTACTCCCTCCTCCT
CCAAACGCGTTATCCACGGTGGCATCAATGTAATTAAACCCAAAATCAAGGGTATTGTTA
TTGTCATTACTTACGGCCGACCAATCTTTCCACTTGGGCTCGCTCTGAACCTCGCAATGG
ATCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGG
TCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATG
TCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTC
GTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGT
GTCTACATT
   
Sequence Name 26-K017400-022-239-B09C-8409
GenBank Accession LN497701 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K017400-022-239-B09C-8409
GACATGAAGCCATTTACAATTGATCCATTGCGAGGTTCAGAGCGAGCCCAAGTGGAAAGA
TTGGTCGGCCGTAAGTAATGACAATAACAATACCCTTGATTTTGGGTTTAATTACATTGA
TGCCACCGTGGATAACGCGTTTGGAGGAGGAGGGAGTAGTAATCAGATGTTTCCGCTACA
GGATATGTTCATGTACATGCAGAAGCCTTACTAGAAGGGAATTCCTTTCCTGCCGCCGAA
ACGCAACGCAAAACGACCCTCGTTTTTGCGTTTATGGCAACACGAGACCGTTTTATATGG
TCAATGAGTGTGCCGATTCGGCCATTAGATTTCTGTTCAGTCTTCGTTTATTCTATAGAC
CGTCCGATTTCAGATCATCCCTAATCGGACGGTGGTCGTTGGATGTATCAGTAGTGTATT
ACTGTGTTAGGTAGAAGAAAATCCACTTGTTCTTAAATTGGCATAAAAGTCAGAAGCTAA
TATTTATATGTGCCGCAATCAATT

Last Updated on 07.07.2016 14:16