Sequences from confirmation amplicon


Confirmation sequences for line 242G06 and hit At2g36990 are shown.
Line ID 242G06
Locus At2g36990 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15538994
Primers used for PCR GI02 - 8474, show primer details
   
Sequence Name 18-K018753-022-242-G06C-GI02
GenBank Accession LN494114 [GenBank]
Sequencing primer gene specific primer, GI02: 5'-TTTTACAAGAAACCTTTTGTGCCT-3'
Sequence (A. th genome BLAST matches underlined)
>18-K018753-022-242-G06C-GI02
CAAAAACATTGCGTTCATTTGAAGCTAACCTGCAATAAGTCCTGAAAGTTGAGTCCACGA
TTCTGATATTGTTTAGCTATATGGACTACCAGACGTAGGTTTGCTGTAATCAACTTTTCC
CGGCTGCTTCTCCCACGGGGGATATCAGATTTTAAGACAGGGGAACTTATCCCCATAGCT
TCAGCCCACTCGCCTATTGTTGGTTCGCAGCCGTTTTGAGATTCAAGTTTAGTCTTTACC
TTCTCCAACTTTAATAAATGCTGATAGATCAAAGATTATGGAAGTTAGCACCAGGGACAA
GAAGGAAGTCCAAGGACACATGAATAAGGAAAGCATGAACCTGTATATGTGATATCAGCT
CAGCTTCTTCTTTAGCAGTCAGAAGTTGTTTTGTCTCAGGTCCCCACAAGAAGAGCTGAA
GCGCATCATCATTATCAGCCCCTTGTTTATACTTTTTCTTCGCACTAGTTTTCTGAGGAA
CATAACCCTCATCGTCCACATCGTTTGATTTTGGAGCCCGTCTGTTCTTTGCTCGTCTCT
CTAGCTGCCGCTTCGATCTTACTATGAGAAATATACATGTAAATGGATCAGGATATATTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
   
Sequence Name 22-K018753-022-242-G06C-8409
GenBank Accession LN495912 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K018753-022-242-G06C-8409
TTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATCCATTTACATGTATATTTC
TCATAGTAAGATCGAAGCGGCAGCTAGAGAGACGAGCAAAGAACAGACGGGCTCCAAAAT
CAAACGATGTGGACGATGAGGGTTATGTTCCTCAGAAAACTAGTGCGAAGAAAAAGTATA
AACAAGGGGCTGATAATGATGATGCGCTTCAGCTCTTCTTGTGGGGACCTGAGACAAAAC
AACTTCTGACTGCTAAAGAAGAAGCTGAGCTGATATCACATATACAGGTTCATGCTTTCC
TTATTCATGTGTCCTTGGACTTCCTTCTTGTCCCTGGTGCTAACTTCCATAATCTTTGAT
CTATCAGCATTTATTAAAGTTGGAGAAGGTAAAGACTAAACTTGAATCTCAAAACGGCTG
CGAACCAACAATAGGCGAGTGGGCTGAAGCTATGGGGATAAGTTCCCCTGTCTTAAAATC
TGATATCCACCGTGGGAGAAGCAGCCGGGAAAAGTTGATTACAGCAAACCTACGTCTGGT
AGTCCATATAGCTAAACAATATCAGAATCGTGGACTCAACTTTCAGGACTTATTGCAGGT
TAGCTTCAAATGAACCCATTGTTTTTGTGTAGGCAC

Last Updated on 23.10.2014 13:25