Sequences from confirmation amplicon


Confirmation sequences for line 255G10 and hit At3g16340 are shown.
Line ID 255G10
Locus At3g16340 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:5539872
Primers used for PCR PE62 - 8474, show primer details
   
Sequence Name 05-K022490-0022-255-G10C-8409
GenBank Accession LN488172 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K022490-0022-255-G10C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGGTAAAGAAGAGAAGGGTTTGTTTATTTATG
CATTTTGATTTGGTAGCCGTTTAAAAAATTTCGGAAAATAAAAAGAAAGCGTGAGGAATA
TGCGGGCTGAGTGGGTAAGAGCTAGGACATGTGGACTAATTAACTAGGTTTTGTTATAGA
AAATTGTATTACGAAATCTAATTGTGGAATTTCTTTTAATTTTACTATATATAAGGGATT
TCCTTGAAGTTTAAACTATGCATACCCTTTTCTTTGAAATACTAGTAAACAATCAACGAC
AAAAACAACTTCTTTCAAACAGTAAATAATAGAACAACAATGGGTCTAGTAAATAATTTG
TCTGGGCCTAAATAAATCATCACATTCGAAACAAGTCCTACCTACATACTTACTAACATT
GTGGTCTAAAAAGAGTAGACAATTGGTCAAAGTTACAAACAAGTCTCTTCAACCCTAAAA
ATCG
   
Sequence Name 06-K022490-0022-255-G10C-PE62
GenBank Accession LN488620 [GenBank]
Sequencing primer gene specific primer, PE62: 5'-TTCCATGTATCGATTTTTAGGGTT-3'
Sequence (A. th genome BLAST matches underlined)
>06-K022490-0022-255-G10C-PE62
TGTTTCTAACTTTGACCAATTGTCTACTCTTTTTAGACCACAATGTTAGTAAGTATGTAG
GTAGGACTTGTTTCGAATGTGATGATTTATTTAGGCCCAGACAAATTATTTACTAGACCC
ATTGTTGTTCTATTATTTACTGTTTGAAAGAAGTTGTTTTTGTCGTTGATTGTTTACTAG
TATTTCAAAGAAAAGGGTATGCATAGTTTAAACTTCAAGGAAATCCCTTATATATAGTAA
AATTAAAAGAAATTCCACAATTAGATTTCGTAATACAATTTTCTATAACAAAACCTAGTT
AATTAGTCCACATGTCCTAGCTCTTACCCACTCAGCCCGCATATTCCTCACGCTTTCTTT
TTATTTTCCGAAATTTTTTAAACGGCTACCAAATCAAAATGCATAAATAAACAAACCCTT
CTCTTCTTTACCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATNGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATT
ACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTT
ATTTCGACGTGTCTACA

Last Updated on 07.07.2016 14:16