Sequences from confirmation amplicon


Confirmation sequences for line 255H04 and hit At2g26150 are shown.
Line ID 255H04
Locus At2g26150 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11135676
Primers used for PCR HV49 - 8474, show primer details
   
Sequence Name 49-K101270-0022-255-H04C-8409
GenBank Accession LN506772 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K101270-0022-255-H04C-8409
GCCATTTGTCGCCTCAATCTCTCAACTCAAAACTCAACATTTTCTGAAGAAAGTCGCAAA
CTTTACCCAAAACCCAGTTTCTAATTTTAGCAACAAAATCAAAAATATCTACTTTTGTTT
CTCGAAAGTTACGAAATTCATACAATCTAGCTTATCTCTGAGCTTATGGATTTGAGATAA
ACAACGAAAATGGAAGAACTGAAAGTGGAAATGGAGGAAGAAACGGTGACGTTTACTGGT
TCTGTAGCGGCTTCTTCATCTGTAGGATCCTCTTCCTCTCCTAGACCAATGGAAGGGCTT
AACGAAACAGGGCCACCACCGTTTCTGACTAAGACTTACGAAATGGTGGAAGATCCGGCG
ACGGACACGGTGGTTTCTTGGAGTAATGGTCGTAACAGCTTTGTGGTGTGGGATTCTCAT
AAGTTCTCAACAACTCTCCTTCCACGTTACTTCAAGCATAGCAATTTCTCAAGTTTTATT
CGTCAGCTCAATACTTATGTAAGTACCTCTTTGCTTCCTTATATCTACTTAGTCTTGTTT
CTGTTTTTGTTTCTNATTTTTAATTTTGGATTTCTTTAGATGGGTTTCCTATGAGTCTTC
AGCTATNANGGTTAGTTCTTTAAGCTTTTAAGTGGCTAANTTGAAATTAGATGCATTGAG
ATTTTGGTCATATGTTAAGAGAATCATTTAACATAAACTCTGTTCAATCCTCTGTTTCTG
AAGTTCANAATGTGTTTGGTAGTAAAAACAGAATCTTGGAATGATAAGTAAGGACTCTG
   
Sequence Name 49-K101276-0022-255-H04C-HV49
GenBank Accession LN506773 [GenBank]
Sequencing primer gene specific primer, HV49: 5'-CTACTGAACTTGAGGCAGAGTCCT-3'
Sequence (A. th genome BLAST matches underlined)
>49-K101276-0022-255-H04C-HV49
ACACATTTTGAACTTCAGAAACAGAGGATTGAACAGAGTTTATGTTAAATGATTCTCTTA
ACATATGACCAAAATCTCAATGCATCTAATTTCAATTTAGCCACTTAAAAGCTTAAAGAA
CTAACCTTTATAGCTGAAGACTCATAGGAAACCCATCTAAAGAAATCCAAAATTAAAAAT
TAGAAACAAAAACAGAAACAAGACTAAGTAGATATAAGGAAGCAAAGAGGTACTTACATA
AGTATTGAGCTGACGAATAAAACTTGAGAAATTGCTATGCTTGAAGTAACGTGGAAGGAG
AGTTGTTGAGAACTTATGAGAATCCCACACCACAAAGCTGTTACGACCATTACTCCAAGA
AACCACCGTGTCCGTCGCCGGATCTTCCACCATTTCGTAAGTCTTAGTCAGAAACGGTGG
TGGCCCTGTTTCGTTAAGCCCTTCCATTGGTCTAGGAGAGGAAGAGGATCCTACAGATGA
AGAAGCCGCTACAGAACCAGTAAACGTCACCGTTTCTTCCTCCATTTCCACTTTCAGTTC
TTCCATTTTCGTTGTTTATCTCAAATCCATAAGCTCAGAGATAAGCTAGATTGTATGAAT
TTCGTAACTTTCGAGAAACAAAAGTAGATATTTTTGATTTTGTTGCTAANATTAGAAACT
GGGTTTTGGGTAAAGTTTGCGACTTTCTTCAGAAAATGTTGAGTTTTGAGTTGAGAGATT
GAGGCGACNAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGT
CAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATGTAGA

Last Updated on 07.07.2016 14:16